Incidental Mutation 'R8257:Ankrd34a'
ID640498
Institutional Source Beutler Lab
Gene Symbol Ankrd34a
Ensembl Gene ENSMUSG00000049097
Gene Nameankyrin repeat domain 34A
SynonymsAnkrd34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96596636-96599775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96597729 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 83 (H83L)
Ref Sequence ENSEMBL: ENSMUSP00000102707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058943] [ENSMUST00000062058] [ENSMUST00000091924] [ENSMUST00000145001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058943
AA Change: H83L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102707
Gene: ENSMUSG00000049097
AA Change: H83L

DomainStartEndE-ValueType
ANK 4 33 9.05e2 SMART
ANK 37 72 2.81e-4 SMART
ANK 76 106 5.84e-2 SMART
ANK 110 139 7.99e2 SMART
low complexity region 216 244 N/A INTRINSIC
low complexity region 350 366 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091924
SMART Domains Protein: ENSMUSP00000089544
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 217 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145001
SMART Domains Protein: ENSMUSP00000118943
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 148 4.4e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Ddx50 T C 10: 62,616,520 probably benign Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Ankrd34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Ankrd34a APN 3 96598913 missense probably benign 0.33
R0190:Ankrd34a UTSW 3 96597789 missense probably damaging 0.99
R1940:Ankrd34a UTSW 3 96598676 missense probably benign 0.28
R3779:Ankrd34a UTSW 3 96598931 missense possibly damaging 0.85
R5427:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5429:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5430:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R6129:Ankrd34a UTSW 3 96597958 nonsense probably null
R6621:Ankrd34a UTSW 3 96598215 missense possibly damaging 0.91
R6891:Ankrd34a UTSW 3 96598019 missense probably benign 0.00
R6951:Ankrd34a UTSW 3 96598422 missense possibly damaging 0.77
R7085:Ankrd34a UTSW 3 96598629 missense probably benign
R7478:Ankrd34a UTSW 3 96598500 missense possibly damaging 0.65
R8746:Ankrd34a UTSW 3 96597475 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGACAGGGTAAGCTAC -3'
(R):5'- GTCGTTATGATGATGACCTCCG -3'

Sequencing Primer
(F):5'- GCTACGCTTGGCCCGTTTG -3'
(R):5'- ATGATGATGACCTCCGTGCCC -3'
Posted On2020-07-28