Incidental Mutation 'R8257:1600015I10Rik'
ID640508
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene NameRIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48929895-48933687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48932497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 559 (T559A)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: T559A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: T559A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Ddx50 T C 10: 62,616,520 probably benign Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCATCTTCTTGGCAGTTGC -3'
(R):5'- ACTCACCTGGTCCAAGAGAC -3'

Sequencing Primer
(F):5'- CCTATGGTTATGGCTTAGTTGGAGAC -3'
(R):5'- GTCCAAGAGACACCTTGCTTC -3'
Posted On2020-07-28