Incidental Mutation 'R8257:Nckipsd'
ID 640519
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene Name NCK interacting protein with SH3 domain
Synonyms ORF1, DIP1, Wasbp, SPIN90, AF3P21, WISH
MMRRC Submission 067683-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.438) question?
Stock # R8257 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108685567-108696043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108692127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 516 (E516G)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000194819] [ENSMUST00000195323]
AlphaFold Q9ESJ4
Predicted Effect probably benign
Transcript: ENSMUST00000035218
AA Change: E516G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: E516G

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.4788 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,950,153 (GRCm39) K1350R probably benign Het
4933407L21Rik T A 1: 85,859,060 (GRCm39) C70* probably null Het
Akr1c6 G A 13: 4,488,525 (GRCm39) V97I probably benign Het
Alg9 A T 9: 50,690,387 (GRCm39) I130F possibly damaging Het
Ankle2 G T 5: 110,401,781 (GRCm39) probably null Het
Ankrd34a A T 3: 96,505,045 (GRCm39) H83L possibly damaging Het
Aoc1l2 A G 6: 48,909,431 (GRCm39) T559A probably benign Het
Ate1 T C 7: 130,069,037 (GRCm39) Y367C probably damaging Het
Atg9b C T 5: 24,591,303 (GRCm39) probably benign Het
Atp2c1 A G 9: 105,308,756 (GRCm39) S626P probably benign Het
Ccdc171 A G 4: 83,614,606 (GRCm39) N1069S probably damaging Het
Cdh20 A G 1: 104,921,962 (GRCm39) D753G probably benign Het
Cdk11b A G 4: 155,732,398 (GRCm39) E517G unknown Het
Chst5 A T 8: 112,617,092 (GRCm39) V176E probably damaging Het
Ddx50 T C 10: 62,452,299 (GRCm39) probably benign Het
Dspp A G 5: 104,324,867 (GRCm39) D410G probably benign Het
Dync1h1 T A 12: 110,602,908 (GRCm39) V2183E probably damaging Het
Emilin2 A G 17: 71,580,995 (GRCm39) V577A probably benign Het
Entpd2 T A 2: 25,288,133 (GRCm39) L119Q probably damaging Het
Foxa1 A T 12: 57,589,932 (GRCm39) M96K probably benign Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
H2-Aa T C 17: 34,502,211 (GRCm39) T237A probably damaging Het
Itih4 G A 14: 30,609,825 (GRCm39) V52I possibly damaging Het
Kntc1 T C 5: 123,896,586 (GRCm39) probably null Het
Lgi4 A T 7: 30,766,766 (GRCm39) probably null Het
Map4k2 G A 19: 6,396,030 (GRCm39) R455H probably benign Het
Masp2 A G 4: 148,687,497 (GRCm39) T95A possibly damaging Het
Mtmr12 T C 15: 12,259,684 (GRCm39) I351T possibly damaging Het
Ncdn A G 4: 126,643,676 (GRCm39) probably null Het
Nlrp12 A G 7: 3,297,962 (GRCm39) W70R probably damaging Het
Nmral1 T A 16: 4,534,267 (GRCm39) D58V probably damaging Het
Nr2c1 A G 10: 94,028,769 (GRCm39) Y522C probably damaging Het
Or14c45 A G 7: 86,176,678 (GRCm39) T238A possibly damaging Het
Or1e23 A G 11: 73,407,203 (GRCm39) M274T probably benign Het
Or2d3b A G 7: 106,513,926 (GRCm39) I174V probably benign Het
Or2w1b A G 13: 21,300,543 (GRCm39) N227S probably benign Het
Pcdhga6 T A 18: 37,841,868 (GRCm39) N529K probably benign Het
Pkmyt1 C T 17: 23,953,148 (GRCm39) R235W probably benign Het
Prss43 T C 9: 110,659,880 (GRCm39) S315P possibly damaging Het
Psmd1 T A 1: 86,006,345 (GRCm39) V237E probably damaging Het
Ptprf A G 4: 118,083,476 (GRCm39) Y844H probably damaging Het
Ryr1 C T 7: 28,764,064 (GRCm39) V3089I possibly damaging Het
Slc1a7 A G 4: 107,865,394 (GRCm39) D294G possibly damaging Het
Slc5a10 T A 11: 61,605,873 (GRCm39) T148S probably damaging Het
Spata25 T C 2: 164,669,690 (GRCm39) D107G possibly damaging Het
Stambpl1 A G 19: 34,208,901 (GRCm39) E132G probably damaging Het
Tgfb1 A G 7: 25,396,373 (GRCm39) H222R probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trmt1l T A 1: 151,304,629 (GRCm39) M1K probably null Het
Vmn2r86 A T 10: 130,288,279 (GRCm39) H407Q possibly damaging Het
Wdr36 T A 18: 32,974,339 (GRCm39) probably benign Het
Zfp35 T A 18: 24,137,288 (GRCm39) I544N possibly damaging Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108,692,168 (GRCm39) missense probably benign 0.07
IGL01601:Nckipsd APN 9 108,691,154 (GRCm39) missense probably benign 0.00
IGL01809:Nckipsd APN 9 108,694,753 (GRCm39) missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108,688,813 (GRCm39) missense probably benign
R0714:Nckipsd UTSW 9 108,691,333 (GRCm39) unclassified probably benign
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108,689,778 (GRCm39) missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108,689,571 (GRCm39) missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108,691,863 (GRCm39) splice site probably null
R2127:Nckipsd UTSW 9 108,688,932 (GRCm39) missense probably benign
R3697:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108,688,320 (GRCm39) missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108,691,275 (GRCm39) missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108,691,938 (GRCm39) missense probably benign 0.28
R4879:Nckipsd UTSW 9 108,691,114 (GRCm39) unclassified probably benign
R5796:Nckipsd UTSW 9 108,688,813 (GRCm39) missense probably benign
R5891:Nckipsd UTSW 9 108,685,808 (GRCm39) missense probably damaging 1.00
R5943:Nckipsd UTSW 9 108,689,435 (GRCm39) missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108,691,176 (GRCm39) missense probably benign 0.00
R6144:Nckipsd UTSW 9 108,689,585 (GRCm39) missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108,688,882 (GRCm39) missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108,691,280 (GRCm39) missense probably benign 0.30
R7676:Nckipsd UTSW 9 108,692,153 (GRCm39) missense probably damaging 1.00
R7702:Nckipsd UTSW 9 108,691,216 (GRCm39) nonsense probably null
R7893:Nckipsd UTSW 9 108,692,588 (GRCm39) missense probably damaging 1.00
R9327:Nckipsd UTSW 9 108,691,699 (GRCm39) missense possibly damaging 0.49
R9353:Nckipsd UTSW 9 108,691,471 (GRCm39) missense probably damaging 0.99
R9484:Nckipsd UTSW 9 108,689,837 (GRCm39) missense probably damaging 1.00
Y4335:Nckipsd UTSW 9 108,694,744 (GRCm39) missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108,691,876 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATCAAACCCTAAGCAGTGGGC -3'
(R):5'- ATGATGACATTCTGCTCAGGAG -3'

Sequencing Primer
(F):5'- CACAAGGCCCCAGAGGTAAG -3'
(R):5'- CTCAGGAGCTGCGGAGAGAC -3'
Posted On 2020-07-28