Incidental Mutation 'R8257:Nr2c1'
ID640521
Institutional Source Beutler Lab
Gene Symbol Nr2c1
Ensembl Gene ENSMUSG00000005897
Gene Namenuclear receptor subfamily 2, group C, member 1
Synonyms4831444H07Rik, Tr2-11, Eenr, TR2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8257 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location94148023-94197211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94192907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 522 (Y522C)
Ref Sequence ENSEMBL: ENSMUSP00000100927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092213] [ENSMUST00000099343] [ENSMUST00000105290]
Predicted Effect probably damaging
Transcript: ENSMUST00000092213
AA Change: Y522C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089858
Gene: ENSMUSG00000005897
AA Change: Y522C

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099343
AA Change: Y522C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096945
Gene: ENSMUSG00000005897
AA Change: Y522C

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105290
AA Change: Y522C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100927
Gene: ENSMUSG00000005897
AA Change: Y522C

DomainStartEndE-ValueType
ZnF_C4 98 169 3.18e-38 SMART
HOLI 382 548 4.94e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any defects in testis development or in spermatogenesis; no gross defects were detected in the central nervous system and normal motor neuron cell numbers were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Nr2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Nr2c1 APN 10 94190690 missense probably damaging 0.97
IGL02739:Nr2c1 APN 10 94156972 missense probably damaging 0.99
chillax UTSW 10 94163786 missense probably benign 0.38
R0077:Nr2c1 UTSW 10 94188255 missense probably benign 0.01
R0349:Nr2c1 UTSW 10 94195182 missense probably damaging 1.00
R0401:Nr2c1 UTSW 10 94171158 missense probably benign 0.02
R0418:Nr2c1 UTSW 10 94181512 missense probably benign 0.00
R0662:Nr2c1 UTSW 10 94190738 missense probably damaging 1.00
R1665:Nr2c1 UTSW 10 94188183 missense probably damaging 1.00
R1802:Nr2c1 UTSW 10 94163786 missense possibly damaging 0.95
R4812:Nr2c1 UTSW 10 94188252 missense probably benign 0.00
R5549:Nr2c1 UTSW 10 94167696 missense probably benign
R5928:Nr2c1 UTSW 10 94188193 missense probably damaging 1.00
R6219:Nr2c1 UTSW 10 94163786 missense probably benign 0.38
R6430:Nr2c1 UTSW 10 94195341 missense possibly damaging 0.77
R6431:Nr2c1 UTSW 10 94188216 missense probably damaging 1.00
R6745:Nr2c1 UTSW 10 94190664 missense probably damaging 1.00
R6844:Nr2c1 UTSW 10 94171167 nonsense probably null
R7707:Nr2c1 UTSW 10 94188165 missense probably benign 0.00
R7848:Nr2c1 UTSW 10 94190646 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGAACTGTTTGATCCTCTGTCC -3'
(R):5'- TCGACCATCACATTACGGCC -3'

Sequencing Primer
(F):5'- AACTGTTTGATCCTCTGTCCTCTGC -3'
(R):5'- ATGGTGCCACATGCCTATG -3'
Posted On2020-07-28