Incidental Mutation 'R8257:Vmn2r86'
ID640522
Institutional Source Beutler Lab
Gene Symbol Vmn2r86
Ensembl Gene ENSMUSG00000092162
Gene Namevomeronasal 2, receptor 86
SynonymsEG625109
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130445707-130455894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130452410 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 407 (H407Q)
Ref Sequence ENSEMBL: ENSMUSP00000126596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170257
AA Change: H407Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126596
Gene: ENSMUSG00000092162
AA Change: H407Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 1.1e-25 PFAM
Pfam:NCD3G 508 562 2.4e-19 PFAM
Pfam:7tm_3 595 829 6.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Ddx50 T C 10: 62,616,520 probably benign Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Vmn2r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Vmn2r86 APN 10 130453026 missense probably damaging 0.99
IGL01328:Vmn2r86 APN 10 130452496 missense possibly damaging 0.78
IGL01377:Vmn2r86 APN 10 130452986 missense probably damaging 0.99
IGL01548:Vmn2r86 APN 10 130446282 missense probably benign 0.22
IGL01804:Vmn2r86 APN 10 130452989 missense probably damaging 0.99
IGL01921:Vmn2r86 APN 10 130455741 missense probably benign 0.00
IGL02406:Vmn2r86 APN 10 130448639 missense possibly damaging 0.81
IGL02625:Vmn2r86 APN 10 130452912 missense probably damaging 1.00
IGL02960:Vmn2r86 APN 10 130453767 missense possibly damaging 0.74
IGL03104:Vmn2r86 APN 10 130446632 missense probably damaging 1.00
R0408:Vmn2r86 UTSW 10 130446854 missense probably damaging 1.00
R0437:Vmn2r86 UTSW 10 130446543 missense probably damaging 1.00
R0577:Vmn2r86 UTSW 10 130452575 missense probably benign 0.04
R0726:Vmn2r86 UTSW 10 130446396 missense probably damaging 1.00
R0811:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R0812:Vmn2r86 UTSW 10 130453628 missense probably benign 0.00
R1055:Vmn2r86 UTSW 10 130446357 missense probably damaging 1.00
R1066:Vmn2r86 UTSW 10 130446276 missense probably benign 0.01
R1199:Vmn2r86 UTSW 10 130448574 splice site probably benign
R1332:Vmn2r86 UTSW 10 130446870 missense probably damaging 1.00
R1568:Vmn2r86 UTSW 10 130453141 missense probably benign 0.09
R1866:Vmn2r86 UTSW 10 130446386 missense probably damaging 1.00
R1897:Vmn2r86 UTSW 10 130452445 missense probably damaging 1.00
R2017:Vmn2r86 UTSW 10 130446713 missense probably benign 0.39
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3162:Vmn2r86 UTSW 10 130455804 missense probably damaging 0.99
R3858:Vmn2r86 UTSW 10 130455725 missense probably benign
R4049:Vmn2r86 UTSW 10 130447097 missense probably damaging 0.98
R4378:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4411:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4413:Vmn2r86 UTSW 10 130452600 missense possibly damaging 0.67
R4422:Vmn2r86 UTSW 10 130452976 missense possibly damaging 0.87
R4738:Vmn2r86 UTSW 10 130447070 missense probably damaging 0.99
R4767:Vmn2r86 UTSW 10 130455737 missense probably benign 0.00
R4872:Vmn2r86 UTSW 10 130453591 missense probably damaging 0.98
R4880:Vmn2r86 UTSW 10 130453615 missense probably benign 0.33
R5092:Vmn2r86 UTSW 10 130446587 missense probably damaging 1.00
R5421:Vmn2r86 UTSW 10 130446936 missense probably benign 0.41
R6007:Vmn2r86 UTSW 10 130453666 missense probably damaging 1.00
R6330:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R6355:Vmn2r86 UTSW 10 130455894 start codon destroyed probably damaging 0.98
R6397:Vmn2r86 UTSW 10 130446262 nonsense probably null
R6419:Vmn2r86 UTSW 10 130446926 missense probably damaging 1.00
R6933:Vmn2r86 UTSW 10 130446257 missense probably damaging 1.00
R6937:Vmn2r86 UTSW 10 130448654 missense probably damaging 1.00
R6959:Vmn2r86 UTSW 10 130446531 missense probably damaging 1.00
R7010:Vmn2r86 UTSW 10 130455857 missense probably benign
R7549:Vmn2r86 UTSW 10 130446828 missense probably damaging 1.00
R8179:Vmn2r86 UTSW 10 130453084 missense probably benign 0.00
R8286:Vmn2r86 UTSW 10 130449986 missense probably benign 0.03
R8479:Vmn2r86 UTSW 10 130446866 missense probably damaging 1.00
R8805:Vmn2r86 UTSW 10 130446527 missense probably benign 0.05
R8960:Vmn2r86 UTSW 10 130453803 missense probably benign 0.27
R9021:Vmn2r86 UTSW 10 130447065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGATCATATGCCCCAGTACAGG -3'
(R):5'- ACTTTTGCACACCACAAAGG -3'

Sequencing Primer
(F):5'- CCAGTACAGGGGAATGCC -3'
(R):5'- TTTTATGCAAACAATGAACACTTCC -3'
Posted On2020-07-28