Incidental Mutation 'R8257:Slc5a10'
ID640523
Institutional Source Beutler Lab
Gene Symbol Slc5a10
Ensembl Gene ENSMUSG00000042371
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 10
SynonymsC330021F16Rik, SGLT5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61672781-61720826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61715047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 148 (T148S)
Ref Sequence ENSEMBL: ENSMUSP00000054407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably damaging
Transcript: ENSMUST00000051552
AA Change: T148S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371
AA Change: T148S

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148584
AA Change: T148S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371
AA Change: T148S

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151780
AA Change: T146S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371
AA Change: T146S

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired fructose reabsorption in the kidneys and exacerbated hepatic steatosis induced by fructose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Ddx50 T C 10: 62,616,520 probably benign Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Olfr382 A G 11: 73,516,377 M274T probably benign Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Slc5a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Slc5a10 APN 11 61715136 missense probably damaging 0.99
IGL02215:Slc5a10 APN 11 61673912 missense probably benign 0.00
IGL02354:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02361:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02573:Slc5a10 APN 11 61673072 missense possibly damaging 0.89
IGL02712:Slc5a10 APN 11 61707806 nonsense probably null
R1535:Slc5a10 UTSW 11 61673941 missense possibly damaging 0.65
R1659:Slc5a10 UTSW 11 61676244 missense possibly damaging 0.94
R1698:Slc5a10 UTSW 11 61709602 missense probably benign 0.44
R2161:Slc5a10 UTSW 11 61719934 missense probably null 0.17
R4948:Slc5a10 UTSW 11 61719882 missense probably damaging 0.98
R5686:Slc5a10 UTSW 11 61678566 missense probably benign 0.19
R5689:Slc5a10 UTSW 11 61707884 missense probably benign 0.16
R7398:Slc5a10 UTSW 11 61673579 missense probably benign
R7769:Slc5a10 UTSW 11 61673647 missense probably damaging 1.00
R8234:Slc5a10 UTSW 11 61673281 missense probably benign
R8492:Slc5a10 UTSW 11 61673983 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAGCATCAGGAGATTCTGCC -3'
(R):5'- TATCTTCAGAGGTGAGTCTCTTCC -3'

Sequencing Primer
(F):5'- ATCAGGAGATTCTGCCCAGGTTAC -3'
(R):5'- AGTCTCTTCCTGGGGCCATG -3'
Posted On2020-07-28