Incidental Mutation 'R8257:Olfr382'
ID640524
Institutional Source Beutler Lab
Gene Symbol Olfr382
Ensembl Gene ENSMUSG00000095312
Gene Nameolfactory receptor 382
SynonymsMOR135-31_p, MOR135-14, GA_x6K02T2P1NL-3676608-3675670
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R8257 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73516259-73517197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73516377 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 274 (M274T)
Ref Sequence ENSEMBL: ENSMUSP00000091575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092921]
Predicted Effect probably benign
Transcript: ENSMUST00000092921
AA Change: M274T

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091575
Gene: ENSMUSG00000095312
AA Change: M274T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-10 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,497 T559A probably benign Het
4930407I10Rik A G 15: 82,065,952 K1350R probably benign Het
4933407L21Rik T A 1: 85,931,339 C70* probably null Het
Akr1c6 G A 13: 4,438,526 V97I probably benign Het
Alg9 A T 9: 50,779,087 I130F possibly damaging Het
Ankle2 G T 5: 110,253,915 probably null Het
Ankrd34a A T 3: 96,597,729 H83L possibly damaging Het
Ate1 T C 7: 130,467,307 Y367C probably damaging Het
Atg9b C T 5: 24,386,305 probably benign Het
Atp2c1 A G 9: 105,431,557 S626P probably benign Het
Ccdc171 A G 4: 83,696,369 N1069S probably damaging Het
Cdh20 A G 1: 104,994,237 D753G probably benign Het
Cdk11b A G 4: 155,647,941 E517G unknown Het
Chst5 A T 8: 111,890,460 V176E probably damaging Het
Ddx50 T C 10: 62,616,520 probably benign Het
Dspp A G 5: 104,177,001 D410G probably benign Het
Dync1h1 T A 12: 110,636,474 V2183E probably damaging Het
Emilin2 A G 17: 71,274,000 V577A probably benign Het
Entpd2 T A 2: 25,398,121 L119Q probably damaging Het
Foxa1 A T 12: 57,543,146 M96K probably benign Het
Ggnbp2 C T 11: 84,837,989 probably null Het
H2-Aa T C 17: 34,283,237 T237A probably damaging Het
Itih4 G A 14: 30,887,868 V52I possibly damaging Het
Kntc1 T C 5: 123,758,523 probably null Het
Lgi4 A T 7: 31,067,341 probably null Het
Map4k2 G A 19: 6,346,000 R455H probably benign Het
Masp2 A G 4: 148,603,040 T95A possibly damaging Het
Mtmr12 T C 15: 12,259,598 I351T possibly damaging Het
Ncdn A G 4: 126,749,883 probably null Het
Nckipsd A G 9: 108,814,928 E516G probably benign Het
Nlrp12 A G 7: 3,249,332 W70R probably damaging Het
Nmral1 T A 16: 4,716,403 D58V probably damaging Het
Nr2c1 A G 10: 94,192,907 Y522C probably damaging Het
Olfr1369-ps1 A G 13: 21,116,373 N227S probably benign Het
Olfr1532-ps1 A G 7: 106,914,719 I174V probably benign Het
Olfr297 A G 7: 86,527,470 T238A possibly damaging Het
Pcdhga6 T A 18: 37,708,815 N529K probably benign Het
Pkmyt1 C T 17: 23,734,174 R235W probably benign Het
Prss43 T C 9: 110,830,812 S315P possibly damaging Het
Psmd1 T A 1: 86,078,623 V237E probably damaging Het
Ptprf A G 4: 118,226,279 Y844H probably damaging Het
Ryr1 C T 7: 29,064,639 V3089I possibly damaging Het
Slc1a7 A G 4: 108,008,197 D294G possibly damaging Het
Slc5a10 T A 11: 61,715,047 T148S probably damaging Het
Spata25 T C 2: 164,827,770 D107G possibly damaging Het
Stambpl1 A G 19: 34,231,501 E132G probably damaging Het
Tgfb1 A G 7: 25,696,948 H222R probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt1l T A 1: 151,428,878 M1K probably null Het
Vmn2r86 A T 10: 130,452,410 H407Q possibly damaging Het
Wdr36 T A 18: 32,841,286 probably benign Het
Zfp35 T A 18: 24,004,231 I544N possibly damaging Het
Other mutations in Olfr382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Olfr382 APN 11 73516410 missense possibly damaging 0.59
IGL00896:Olfr382 APN 11 73516341 missense probably damaging 1.00
IGL01723:Olfr382 APN 11 73516626 missense probably damaging 1.00
IGL01734:Olfr382 APN 11 73516636 missense probably benign 0.39
IGL02267:Olfr382 APN 11 73516549 missense probably benign 0.44
IGL02681:Olfr382 APN 11 73516530 missense probably benign
IGL03165:Olfr382 APN 11 73516884 nonsense probably null
BB009:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
BB019:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
IGL03134:Olfr382 UTSW 11 73517115 missense probably benign 0.02
R0320:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0633:Olfr382 UTSW 11 73516927 missense probably benign 0.23
R0638:Olfr382 UTSW 11 73516924 missense probably damaging 1.00
R0691:Olfr382 UTSW 11 73516844 missense possibly damaging 0.55
R1630:Olfr382 UTSW 11 73516720 missense probably damaging 1.00
R2269:Olfr382 UTSW 11 73516483 missense probably damaging 1.00
R4001:Olfr382 UTSW 11 73516986 missense probably damaging 1.00
R4925:Olfr382 UTSW 11 73517172 missense possibly damaging 0.87
R5707:Olfr382 UTSW 11 73516625 missense probably damaging 1.00
R5911:Olfr382 UTSW 11 73516525 missense probably damaging 1.00
R6225:Olfr382 UTSW 11 73517005 missense probably damaging 0.99
R6251:Olfr382 UTSW 11 73516708 missense probably benign 0.00
R6332:Olfr382 UTSW 11 73517175 missense probably benign 0.00
R7013:Olfr382 UTSW 11 73516421 nonsense probably null
R7196:Olfr382 UTSW 11 73517131 missense probably benign
R7443:Olfr382 UTSW 11 73516848 missense possibly damaging 0.89
R7932:Olfr382 UTSW 11 73517157 missense probably damaging 1.00
R8201:Olfr382 UTSW 11 73517073 missense probably damaging 1.00
R8547:Olfr382 UTSW 11 73516614 missense probably damaging 1.00
Z1177:Olfr382 UTSW 11 73517035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAAACTCCTGCTTGC -3'
(R):5'- AAGTTGGCTTGCTCTGACATTC -3'

Sequencing Primer
(F):5'- TGCAAAACTCCTGCTTGCAAATAG -3'
(R):5'- GGCTTGCTCTGACATTCATATTAATG -3'
Posted On2020-07-28