Incidental Mutation 'R8256:Atg9a'
ID 640542
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 067682-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8256 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75163563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 179 (T179I)
Ref Sequence ENSEMBL: ENSMUSP00000047449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect possibly damaging
Transcript: ENSMUST00000040689
AA Change: T179I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: T179I

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect possibly damaging
Transcript: ENSMUST00000188347
AA Change: T179I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: T179I

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189702
AA Change: T179I

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: T179I

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A T 16: 30,958,287 (GRCm39) probably null Het
Acsbg1 A T 9: 54,525,345 (GRCm39) M402K probably damaging Het
Adamts2 T C 11: 50,683,583 (GRCm39) V955A probably benign Het
Adcy2 C T 13: 68,768,880 (GRCm39) E1083K probably damaging Het
Adgrb2 G A 4: 129,901,921 (GRCm39) A484T probably damaging Het
Adgrv1 G T 13: 81,727,679 (GRCm39) D320E probably damaging Het
Arf4 T C 14: 26,377,126 (GRCm39) S178P probably benign Het
Atp13a2 A C 4: 140,722,922 (GRCm39) Q225P possibly damaging Het
Axdnd1 T C 1: 156,158,236 (GRCm39) T1105A unknown Het
Bltp2 T A 11: 78,167,979 (GRCm39) D1471E probably benign Het
Ccdc68 G T 18: 70,072,018 (GRCm39) E32* probably null Het
Chd9 T C 8: 91,660,129 (GRCm39) V363A unknown Het
Cmya5 C T 13: 93,229,986 (GRCm39) E1701K possibly damaging Het
Def8 T C 8: 124,186,368 (GRCm39) F369S probably damaging Het
Dhx8 C T 11: 101,631,588 (GRCm39) P394S possibly damaging Het
Fbxo3 A G 2: 103,864,008 (GRCm39) R88G probably damaging Het
Gstm4 A G 3: 107,951,667 (GRCm39) probably null Het
Hira A G 16: 18,744,443 (GRCm39) T387A probably benign Het
Hspbap1 A G 16: 35,590,879 (GRCm39) T12A probably benign Het
Lipi G A 16: 75,370,950 (GRCm39) A89V probably benign Het
Lsamp A T 16: 41,965,007 (GRCm39) Y305F probably damaging Het
Ltbp1 T A 17: 75,622,236 (GRCm39) probably benign Het
Mphosph9 C T 5: 124,393,169 (GRCm39) D1116N probably damaging Het
Mylip T C 13: 45,561,833 (GRCm39) C277R probably damaging Het
Mylk4 T C 13: 32,904,522 (GRCm39) D204G probably damaging Het
Ncf2 G A 1: 152,692,851 (GRCm39) probably null Het
Or2n1e T G 17: 38,586,411 (GRCm39) L250V probably damaging Het
Plekhg3 T C 12: 76,609,041 (GRCm39) L138P probably damaging Het
Pramel27 A G 4: 143,578,255 (GRCm39) R172G probably benign Het
Ptk6 T A 2: 180,837,633 (GRCm39) K429* probably null Het
Rasgrp4 T C 7: 28,842,500 (GRCm39) V258A probably damaging Het
Rp1l1 T C 14: 64,265,602 (GRCm39) L396S probably benign Het
Samd8 A T 14: 21,833,745 (GRCm39) probably null Het
Spock1 T A 13: 57,588,257 (GRCm39) I269F probably damaging Het
Tap2 A G 17: 34,435,006 (GRCm39) D683G probably benign Het
Terb1 T C 8: 105,199,579 (GRCm39) D455G possibly damaging Het
Tnfaip8l3 A G 9: 53,934,528 (GRCm39) V149A probably benign Het
Ubr7 T A 12: 102,736,170 (GRCm39) M364K probably damaging Het
Vmn1r121 T G 7: 20,831,679 (GRCm39) N254H probably benign Het
Zfp804a A G 2: 81,884,193 (GRCm39) N20S probably damaging Het
Zhx1 T C 15: 57,916,359 (GRCm39) K629R probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGAAGACAACCTCTCCGAG -3'
(R):5'- GCAGGTCAGGAAATATCTTTGC -3'

Sequencing Primer
(F):5'- CGATGGTAGATGTCCAAC -3'
(R):5'- TGGAACTCACTCTGTAGCCTGG -3'
Posted On 2020-07-28