Incidental Mutation 'R8256:Axdnd1'
ID 640544
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms LOC381304, 9430070O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8256 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 156323509-156421159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156330666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1105 (T1105A)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027896] [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000193020] [ENSMUST00000212747] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027896
SMART Domains Protein: ENSMUSP00000027896
Gene: ENSMUSG00000026602

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
PHB 125 284 7.31e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177824
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193020
SMART Domains Protein: ENSMUSP00000141328
Gene: ENSMUSG00000026602

DomainStartEndE-ValueType
PHB 50 201 7.6e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212747
AA Change: T269A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect unknown
Transcript: ENSMUST00000213088
AA Change: T1105A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,277,153 D1471E probably benign Het
Acap2 A T 16: 31,139,469 probably null Het
Acsbg1 A T 9: 54,618,061 M402K probably damaging Het
Adamts2 T C 11: 50,792,756 V955A probably benign Het
Adcy2 C T 13: 68,620,761 E1083K probably damaging Het
Adgrb2 G A 4: 130,008,128 A484T probably damaging Het
Adgrv1 G T 13: 81,579,560 D320E probably damaging Het
Arf4 T C 14: 26,655,971 S178P probably benign Het
Atg9a G A 1: 75,186,919 T179I possibly damaging Het
Atp13a2 A C 4: 140,995,611 Q225P possibly damaging Het
Ccdc68 G T 18: 69,938,947 E32* probably null Het
Chd9 T C 8: 90,933,501 V363A unknown Het
Cmya5 C T 13: 93,093,478 E1701K possibly damaging Het
Def8 T C 8: 123,459,629 F369S probably damaging Het
Dhx8 C T 11: 101,740,762 P394S possibly damaging Het
Fbxo3 A G 2: 104,033,663 R88G probably damaging Het
Gm13103 A G 4: 143,851,685 R172G probably benign Het
Gstm4 A G 3: 108,044,351 probably null Het
Hira A G 16: 18,925,693 T387A probably benign Het
Hspbap1 A G 16: 35,770,509 T12A probably benign Het
Lipi G A 16: 75,574,062 A89V probably benign Het
Lsamp A T 16: 42,144,644 Y305F probably damaging Het
Ltbp1 T A 17: 75,315,241 probably benign Het
Mphosph9 C T 5: 124,255,106 D1116N probably damaging Het
Mylip T C 13: 45,408,357 C277R probably damaging Het
Mylk4 T C 13: 32,720,539 D204G probably damaging Het
Ncf2 G A 1: 152,817,100 probably null Het
Olfr138 T G 17: 38,275,520 L250V probably damaging Het
Plekhg3 T C 12: 76,562,267 L138P probably damaging Het
Ptk6 T A 2: 181,195,840 K429* probably null Het
Rasgrp4 T C 7: 29,143,075 V258A probably damaging Het
Rp1l1 T C 14: 64,028,153 L396S probably benign Het
Samd8 A T 14: 21,783,677 probably null Het
Spock1 T A 13: 57,440,444 I269F probably damaging Het
Tap2 A G 17: 34,216,032 D683G probably benign Het
Terb1 T C 8: 104,472,947 D455G possibly damaging Het
Tnfaip8l3 A G 9: 54,027,244 V149A probably benign Het
Ubr7 T A 12: 102,769,911 M364K probably damaging Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Zfp804a A G 2: 82,053,849 N20S probably damaging Het
Zhx1 T C 15: 58,052,963 K629R probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156391946 missense
R9207:Axdnd1 UTSW 1 156388046 missense
R9294:Axdnd1 UTSW 1 156420347 nonsense probably null
R9741:Axdnd1 UTSW 1 156341815 missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGCCATGCTTCTAGAG -3'
(R):5'- CTGCATAAGCCTTTATCTTAGAACC -3'

Sequencing Primer
(F):5'- GCTTCTAGAGAGAAATTTTCTTGGC -3'
(R):5'- GTCCTTAGAGGATACCAGTCA -3'
Posted On 2020-07-28