Incidental Mutation 'R8256:Zfp804a'
ID640545
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R8256 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82053849 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 20 (N20S)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect probably damaging
Transcript: ENSMUST00000047527
AA Change: N20S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: N20S

DomainStartEndE-ValueType
ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,277,153 D1471E probably benign Het
Acap2 A T 16: 31,139,469 probably null Het
Acsbg1 A T 9: 54,618,061 M402K probably damaging Het
Adamts2 T C 11: 50,792,756 V955A probably benign Het
Adcy2 C T 13: 68,620,761 E1083K probably damaging Het
Adgrb2 G A 4: 130,008,128 A484T probably damaging Het
Adgrv1 G T 13: 81,579,560 D320E probably damaging Het
Arf4 T C 14: 26,655,971 S178P probably benign Het
Atg9a G A 1: 75,186,919 T179I possibly damaging Het
Atp13a2 A C 4: 140,995,611 Q225P possibly damaging Het
Axdnd1 T C 1: 156,330,666 T1105A unknown Het
Ccdc68 G T 18: 69,938,947 E32* probably null Het
Chd9 T C 8: 90,933,501 V363A unknown Het
Cmya5 C T 13: 93,093,478 E1701K possibly damaging Het
Def8 T C 8: 123,459,629 F369S probably damaging Het
Dhx8 C T 11: 101,740,762 P394S possibly damaging Het
Fbxo3 A G 2: 104,033,663 R88G probably damaging Het
Gm13103 A G 4: 143,851,685 R172G probably benign Het
Gstm4 A G 3: 108,044,351 probably null Het
Hira A G 16: 18,925,693 T387A probably benign Het
Hspbap1 A G 16: 35,770,509 T12A probably benign Het
Lipi G A 16: 75,574,062 A89V probably benign Het
Lsamp A T 16: 42,144,644 Y305F probably damaging Het
Ltbp1 T A 17: 75,315,241 probably benign Het
Mphosph9 C T 5: 124,255,106 D1116N probably damaging Het
Mylip T C 13: 45,408,357 C277R probably damaging Het
Mylk4 T C 13: 32,720,539 D204G probably damaging Het
Ncf2 G A 1: 152,817,100 probably null Het
Olfr138 T G 17: 38,275,520 L250V probably damaging Het
Plekhg3 T C 12: 76,562,267 L138P probably damaging Het
Ptk6 T A 2: 181,195,840 K429* probably null Het
Rasgrp4 T C 7: 29,143,075 V258A probably damaging Het
Rp1l1 T C 14: 64,028,153 L396S probably benign Het
Samd8 A T 14: 21,783,677 probably null Het
Spock1 T A 13: 57,440,444 I269F probably damaging Het
Tap2 A G 17: 34,216,032 D683G probably benign Het
Terb1 T C 8: 104,472,947 D455G possibly damaging Het
Tnfaip8l3 A G 9: 54,027,244 V149A probably benign Het
Ubr7 T A 12: 102,769,911 M364K probably damaging Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Zhx1 T C 15: 58,052,963 K629R probably benign Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0837:Zfp804a UTSW 2 82259162 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1377:Zfp804a UTSW 2 82258497 missense probably benign 0.39
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R2943:Zfp804a UTSW 2 82235879 missense probably damaging 1.00
R3116:Zfp804a UTSW 2 82259417 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R6325:Zfp804a UTSW 2 82257038 missense possibly damaging 0.80
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TAACACTCATGCCTGCCAGC -3'
(R):5'- AGGCAGAGCTTTCCTAAGATTCC -3'

Sequencing Primer
(F):5'- TATCTCCAGGCGAGCACTG -3'
(R):5'- ATACCCGATTCTCATCCCACG -3'
Posted On2020-07-28