Incidental Mutation 'R8256:Ubr7'
ID640564
Institutional Source Beutler Lab
Gene Symbol Ubr7
Ensembl Gene ENSMUSG00000041712
Gene Nameubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R8256 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location102757967-102777707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102769911 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 364 (M364K)
Ref Sequence ENSEMBL: ENSMUSP00000041247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046404]
Predicted Effect probably damaging
Transcript: ENSMUST00000046404
AA Change: M364K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041247
Gene: ENSMUSG00000041712
AA Change: M364K

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:zf-UBR 45 113 2.4e-15 PFAM
PHD 134 186 1.78e-1 SMART
low complexity region 261 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,277,153 D1471E probably benign Het
Acap2 A T 16: 31,139,469 probably null Het
Acsbg1 A T 9: 54,618,061 M402K probably damaging Het
Adamts2 T C 11: 50,792,756 V955A probably benign Het
Adcy2 C T 13: 68,620,761 E1083K probably damaging Het
Adgrb2 G A 4: 130,008,128 A484T probably damaging Het
Adgrv1 G T 13: 81,579,560 D320E probably damaging Het
Arf4 T C 14: 26,655,971 S178P probably benign Het
Atg9a G A 1: 75,186,919 T179I possibly damaging Het
Atp13a2 A C 4: 140,995,611 Q225P possibly damaging Het
Axdnd1 T C 1: 156,330,666 T1105A unknown Het
Ccdc68 G T 18: 69,938,947 E32* probably null Het
Chd9 T C 8: 90,933,501 V363A unknown Het
Cmya5 C T 13: 93,093,478 E1701K possibly damaging Het
Def8 T C 8: 123,459,629 F369S probably damaging Het
Dhx8 C T 11: 101,740,762 P394S possibly damaging Het
Fbxo3 A G 2: 104,033,663 R88G probably damaging Het
Gm13103 A G 4: 143,851,685 R172G probably benign Het
Gstm4 A G 3: 108,044,351 probably null Het
Hira A G 16: 18,925,693 T387A probably benign Het
Hspbap1 A G 16: 35,770,509 T12A probably benign Het
Lipi G A 16: 75,574,062 A89V probably benign Het
Lsamp A T 16: 42,144,644 Y305F probably damaging Het
Mphosph9 C T 5: 124,255,106 D1116N probably damaging Het
Mylip T C 13: 45,408,357 C277R probably damaging Het
Mylk4 T C 13: 32,720,539 D204G probably damaging Het
Ncf2 G A 1: 152,817,100 probably null Het
Olfr138 T G 17: 38,275,520 L250V probably damaging Het
Plekhg3 T C 12: 76,562,267 L138P probably damaging Het
Ptk6 T A 2: 181,195,840 K429* probably null Het
Rasgrp4 T C 7: 29,143,075 V258A probably damaging Het
Rp1l1 T C 14: 64,028,153 L396S probably benign Het
Samd8 A T 14: 21,783,677 probably null Het
Spock1 T A 13: 57,440,444 I269F probably damaging Het
Tap2 A G 17: 34,216,032 D683G probably benign Het
Terb1 T C 8: 104,472,947 D455G possibly damaging Het
Tnfaip8l3 A G 9: 54,027,244 V149A probably benign Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Zfp804a A G 2: 82,053,849 N20S probably damaging Het
Zhx1 T C 15: 58,052,963 K629R probably benign Het
Other mutations in Ubr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ubr7 APN 12 102768276 nonsense probably null
IGL02493:Ubr7 APN 12 102768220 missense probably benign 0.00
IGL02750:Ubr7 APN 12 102771278 missense possibly damaging 0.68
IGL03229:Ubr7 APN 12 102769155 missense probably damaging 1.00
dwindled UTSW 12 102761464 missense probably damaging 1.00
R0519:Ubr7 UTSW 12 102768206 missense probably benign 0.00
R0894:Ubr7 UTSW 12 102769191 missense probably damaging 1.00
R1453:Ubr7 UTSW 12 102769178 missense probably benign 0.00
R1598:Ubr7 UTSW 12 102769894 missense probably damaging 1.00
R2201:Ubr7 UTSW 12 102761505 critical splice donor site probably null
R4731:Ubr7 UTSW 12 102769226 missense probably benign 0.03
R4834:Ubr7 UTSW 12 102761502 missense probably damaging 1.00
R5222:Ubr7 UTSW 12 102775705 missense probably benign 0.09
R5662:Ubr7 UTSW 12 102768267 missense probably benign 0.00
R5845:Ubr7 UTSW 12 102766312 missense probably damaging 0.99
R5867:Ubr7 UTSW 12 102761494 missense probably damaging 1.00
R6257:Ubr7 UTSW 12 102765840 nonsense probably null
R6543:Ubr7 UTSW 12 102768235 missense probably benign 0.01
R6601:Ubr7 UTSW 12 102761464 missense probably damaging 1.00
R6849:Ubr7 UTSW 12 102758083 missense probably damaging 0.98
R7330:Ubr7 UTSW 12 102775712 missense probably damaging 0.99
R7576:Ubr7 UTSW 12 102769139 missense probably damaging 1.00
R8334:Ubr7 UTSW 12 102758138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGTGGAAGTTGGAAGATTTC -3'
(R):5'- TCATGCTGAGGGCTTCTTTC -3'

Sequencing Primer
(F):5'- TGACATTCTAAATGGGGGAACTG -3'
(R):5'- TGCTGGGATTAAAGTATGCACC -3'
Posted On2020-07-28