Mutagenetix > Incidental Mutation

Incidental Mutation 'R0096:Adamts3'

64057

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

038382-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0096 (G1)

Quality Score

101

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 89701717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 615 (Q615*)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably null
Transcript: ENSMUST00000061427
AA Change: Q615*

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: Q615*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163159
AA Change: Q615*

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: Q615*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	C	6: 48,931,188	Q374P	probably damaging	Het
4933405L10Rik	A	T	8: 105,708,931		probably null	Het
Adamtsl3	T	A	7: 82,465,699		probably benign	Het
Anks1b	T	C	10: 90,074,062	S48P	possibly damaging	Het
Arfip2	T	A	7: 105,638,230	K94N	probably damaging	Het
Arhgap42	G	T	9: 9,009,313	N524K	probably damaging	Het
Arhgef28	T	G	13: 97,931,254	T1388P	probably damaging	Het
Arid4b	T	C	13: 14,129,194	V68A	probably benign	Het
BC005537	T	C	13: 24,805,940	F129L	probably damaging	Het
Capn3	A	T	2: 120,502,529	H592L	possibly damaging	Het
Ccdc105	T	A	10: 78,748,705	I328L	probably benign	Het
Dglucy	A	T	12: 100,838,651	I134F	possibly damaging	Het
Dhh	T	A	15: 98,893,988	M380L	probably benign	Het
Dnaic2	A	C	11: 114,754,332	D531A	probably benign	Het
Dthd1	A	T	5: 62,843,040	R568S	possibly damaging	Het
Efr3a	A	G	15: 65,855,441	N613S	probably damaging	Het
Epb41l5	T	A	1: 119,623,911		probably benign	Het
Ermp1	A	G	19: 29,631,388	Y164H	possibly damaging	Het
Fam120c	CCAGCAGCAGCAGCAGCA	CCAGCAGCAGCAGCA	X: 151,344,345		probably benign	Het
Fbrs	C	T	7: 127,489,487	A145V	probably damaging	Het
Gm4736	T	C	6: 132,115,606		noncoding transcript	Het
Gm9873	A	T	2: 169,021,109		noncoding transcript	Het
Grik1	T	C	16: 88,034,226	M219V	possibly damaging	Het
Gtsf1l	C	T	2: 163,087,536	C9Y	probably damaging	Het
Itih5	G	A	2: 10,251,378	R885Q	probably benign	Het
Kdm4c	A	G	4: 74,357,343	E752G	probably damaging	Het
Ksr1	A	G	11: 79,038,247		probably benign	Het
Lama1	T	A	17: 67,805,413	F2283I	probably benign	Het
Luc7l3	A	G	11: 94,301,494		probably benign	Het
Lypd8	A	T	11: 58,386,757	M122L	probably benign	Het
Map1a	A	G	2: 121,301,505	E696G	probably damaging	Het
Mrps34	A	G	17: 24,895,669	D110G	probably damaging	Het
Myh11	T	A	16: 14,204,367	K1710M	possibly damaging	Het
Myo1d	A	G	11: 80,484,332	L972P	probably damaging	Het
Nos1ap	T	C	1: 170,329,247	D214G	probably damaging	Het
Olfr1224-ps1	A	T	2: 89,156,296	M293K	probably benign	Het
Olfr910	A	T	9: 38,539,536	I214F	probably damaging	Het
Pate4	T	G	9: 35,611,834	T5P	probably damaging	Het
Pygl	A	T	12: 70,191,166		probably benign	Het
Samd4	A	T	14: 47,064,297	M252L	possibly damaging	Het
Serpinb1c	T	A	13: 32,886,283		probably benign	Het
Sis	A	T	3: 72,928,267	W921R	probably damaging	Het
Skint5	A	T	4: 113,597,768		probably benign	Het
Slc27a6	T	C	18: 58,598,757		probably benign	Het
Sycp2	G	T	2: 178,403,735	Q31K	probably damaging	Het
Taar7f	A	G	10: 24,050,254	M249V	probably benign	Het
Tarm1	T	C	7: 3,497,551	T79A	probably benign	Het
Trf	A	G	9: 103,222,159	F300L	probably damaging	Het
Vmn1r69	T	A	7: 10,580,058	I170F	probably damaging	Het
Vmn2r105	A	G	17: 20,227,479	F361S	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,319	Y636C	probably damaging	Het
Wdr59	T	C	8: 111,504,373	N68D	probably damaging	Het
Zfp345	T	A	2: 150,472,300	H439L	probably damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- AATGCCTGGCCTCTCTAAGTACCC -3'
(R):5'- ACCCTAGACATTGGAAGGACAGCAC -3'

Sequencing Primer
(F):5'- TTATGTTACCACATAGGCGGGAC -3'
(R):5'- GACAGCACCATTCAGCTTGTG -3'

Posted On

2013-08-06