Incidental Mutation 'R8255:Dnah7c'
ID 640584
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Name dynein, axonemal, heavy chain 7C
Synonyms Dnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R8255 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46425592-46807476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46659429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2174 (S2174P)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000189749
AA Change: S2174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: S2174P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.3348 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,267,731 T648S possibly damaging Het
Abca12 T A 1: 71,319,899 I583F probably benign Het
Abca4 A T 3: 122,155,277 M1732L probably benign Het
Ank2 A G 3: 126,946,749 S1742P unknown Het
Birc6 G A 17: 74,662,780 A4273T probably damaging Het
Chd5 A G 4: 152,379,423 T1450A probably damaging Het
Dhx32 T C 7: 133,737,391 N305S probably benign Het
Fam57b G A 7: 126,824,103 V6M probably benign Het
Fat2 T A 11: 55,270,275 I3210F probably benign Het
Gm12888 A G 4: 121,324,797 S33P probably damaging Het
Gpaa1 T C 15: 76,333,238 L292P probably damaging Het
Gzmg T A 14: 56,158,296 R69W probably damaging Het
Hat1 A G 2: 71,409,003 D40G probably damaging Het
Hcrtr2 T A 9: 76,232,921 I362F probably damaging Het
Hmmr T C 11: 40,707,435 E650G probably damaging Het
Ifi35 A T 11: 101,457,782 M180L probably benign Het
Ifi44 A T 3: 151,745,982 H162Q probably benign Het
Il1rl2 T C 1: 40,365,311 F531L probably damaging Het
Ipcef1 T G 10: 6,920,007 K182T probably benign Het
Med27 C A 2: 29,524,364 probably null Het
Med31 G A 11: 72,215,468 probably benign Het
Moxd1 A G 10: 24,223,802 T67A probably benign Het
Myh3 A G 11: 67,095,022 E1266G probably damaging Het
Nkx2-4 C A 2: 147,084,004 E313* probably null Het
Nol6 G T 4: 41,120,168 R487S probably benign Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr470 A G 7: 107,845,161 S191P probably damaging Het
Olfr56 C A 11: 49,134,480 A96D probably benign Het
Olfr726 C T 14: 50,083,872 V270I noncoding transcript Het
Rnf135 A G 11: 80,193,887 D162G probably benign Het
Sdr42e1 G T 8: 117,663,763 N46K probably benign Het
Skor2 T C 18: 76,858,969 S129P unknown Het
Slc7a11 A T 3: 50,427,728 I190N probably damaging Het
Smc5 A T 19: 23,208,926 F1056I Het
Son A T 16: 91,664,936 Q2243L unknown Het
Sult1a1 T A 7: 126,675,108 I101F possibly damaging Het
Sult3a2 T C 10: 33,779,751 I77M probably benign Het
Tas1r1 A T 4: 152,032,317 S287T probably benign Het
Thbs3 A C 3: 89,225,258 T836P probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfrsf8 A T 4: 145,315,083 M1K probably null Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Vmn1r179 C T 7: 23,929,011 A209V probably benign Het
Wdr31 A T 4: 62,463,397 S66T probably benign Het
Zbtb18 T C 1: 177,447,437 V121A probably damaging Het
Zfp30 T A 7: 29,789,401 M82K probably benign Het
Zzef1 A G 11: 72,875,129 Q1494R probably benign Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7452:Dnah7c UTSW 1 46647036 missense possibly damaging 0.91
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 splice site probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8428:Dnah7c UTSW 1 46672376 missense probably damaging 1.00
R8441:Dnah7c UTSW 1 46533238 missense probably damaging 1.00
R8485:Dnah7c UTSW 1 46680792 missense probably benign 0.05
R8559:Dnah7c UTSW 1 46725139 missense probably damaging 1.00
R8752:Dnah7c UTSW 1 46672541 missense probably benign 0.00
R8869:Dnah7c UTSW 1 46632344 missense probably damaging 0.97
R9058:Dnah7c UTSW 1 46766656 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46665490 missense probably damaging 0.97
R9121:Dnah7c UTSW 1 46777736 missense probably benign 0.00
R9246:Dnah7c UTSW 1 46532774 missense possibly damaging 0.51
R9319:Dnah7c UTSW 1 46482008 missense possibly damaging 0.94
R9388:Dnah7c UTSW 1 46740726 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATCCTGCTGAATTCCAAAGGTTTC -3'
(R):5'- ACTGCCACAGTAGTCCTTGC -3'

Sequencing Primer
(F):5'- GGTTTCTTTGGACACCTCATAAATAC -3'
(R):5'- ACAGTAGTCCTTGCTCTTCTGGAC -3'
Posted On 2020-07-28