Incidental Mutation 'R8255:Tnfrsf8'
ID640598
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8255 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 145315083 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000030339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect probably null
Transcript: ENSMUST00000030339
AA Change: M1K
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123027
AA Change: M1K
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,267,731 T648S possibly damaging Het
Abca12 T A 1: 71,319,899 I583F probably benign Het
Abca4 A T 3: 122,155,277 M1732L probably benign Het
Ank2 A G 3: 126,946,749 S1742P unknown Het
Birc6 G A 17: 74,662,780 A4273T probably damaging Het
Chd5 A G 4: 152,379,423 T1450A probably damaging Het
Dhx32 T C 7: 133,737,391 N305S probably benign Het
Dnah7c T C 1: 46,659,429 S2174P probably damaging Het
Fam57b G A 7: 126,824,103 V6M probably benign Het
Fat2 T A 11: 55,270,275 I3210F probably benign Het
Gm12888 A G 4: 121,324,797 S33P probably damaging Het
Gpaa1 T C 15: 76,333,238 L292P probably damaging Het
Gzmg T A 14: 56,158,296 R69W probably damaging Het
Hat1 A G 2: 71,409,003 D40G probably damaging Het
Hcrtr2 T A 9: 76,232,921 I362F probably damaging Het
Hmmr T C 11: 40,707,435 E650G probably damaging Het
Ifi35 A T 11: 101,457,782 M180L probably benign Het
Ifi44 A T 3: 151,745,982 H162Q probably benign Het
Il1rl2 T C 1: 40,365,311 F531L probably damaging Het
Ipcef1 T G 10: 6,920,007 K182T probably benign Het
Med27 C A 2: 29,524,364 probably null Het
Med31 G A 11: 72,215,468 probably benign Het
Moxd1 A G 10: 24,223,802 T67A probably benign Het
Myh3 A G 11: 67,095,022 E1266G probably damaging Het
Nkx2-4 C A 2: 147,084,004 E313* probably null Het
Nol6 G T 4: 41,120,168 R487S probably benign Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr470 A G 7: 107,845,161 S191P probably damaging Het
Olfr56 C A 11: 49,134,480 A96D probably benign Het
Olfr726 C T 14: 50,083,872 V270I noncoding transcript Het
Rnf135 A G 11: 80,193,887 D162G probably benign Het
Sdr42e1 G T 8: 117,663,763 N46K probably benign Het
Skor2 T C 18: 76,858,969 S129P unknown Het
Slc7a11 A T 3: 50,427,728 I190N probably damaging Het
Smc5 A T 19: 23,208,926 F1056I Het
Son A T 16: 91,664,936 Q2243L unknown Het
Sult1a1 T A 7: 126,675,108 I101F possibly damaging Het
Sult3a2 T C 10: 33,779,751 I77M probably benign Het
Tas1r1 A T 4: 152,032,317 S287T probably benign Het
Thbs3 A C 3: 89,225,258 T836P probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Vmn1r179 C T 7: 23,929,011 A209V probably benign Het
Wdr31 A T 4: 62,463,397 S66T probably benign Het
Zbtb18 T C 1: 177,447,437 V121A probably damaging Het
Zfp30 T A 7: 29,789,401 M82K probably benign Het
Zzef1 A G 11: 72,875,129 Q1494R probably benign Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5632:Tnfrsf8 UTSW 4 145292633 missense possibly damaging 0.68
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R5877:Tnfrsf8 UTSW 4 145292687 missense probably benign 0.20
R6243:Tnfrsf8 UTSW 4 145303101 missense possibly damaging 0.61
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R7505:Tnfrsf8 UTSW 4 145269115 missense probably damaging 1.00
R8354:Tnfrsf8 UTSW 4 145287983 missense probably benign 0.41
R8406:Tnfrsf8 UTSW 4 145292695 missense probably damaging 0.98
R8454:Tnfrsf8 UTSW 4 145287983 missense probably benign 0.41
R8554:Tnfrsf8 UTSW 4 145296941 missense probably damaging 1.00
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAGTTATCCACCCACCTGTG -3'
(R):5'- AGTCATCTCTGCACGTGGTG -3'

Sequencing Primer
(F):5'- CACCTGTGGATGCTTGCATATTTTAG -3'
(R):5'- CTCTCTTAGGCTTCACAGGC -3'
Posted On2020-07-28