Incidental Mutation 'R8255:Sdr42e1'
ID640609
Institutional Source Beutler Lab
Gene Symbol Sdr42e1
Ensembl Gene ENSMUSG00000034308
Gene Nameshort chain dehydrogenase/reductase family 42E, member 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8255 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location117661399-117673689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 117663763 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 46 (N46K)
Ref Sequence ENSEMBL: ENSMUSP00000044457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037955] [ENSMUST00000173522] [ENSMUST00000174450]
Predicted Effect probably benign
Transcript: ENSMUST00000037955
AA Change: N46K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000044457
Gene: ENSMUSG00000034308
AA Change: N46K

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 241 4.2e-14 PFAM
Pfam:Polysacc_synt_2 11 129 7.1e-11 PFAM
Pfam:NAD_binding_10 11 239 3.3e-10 PFAM
Pfam:Epimerase 11 255 6.7e-29 PFAM
Pfam:3Beta_HSD 12 285 3.1e-69 PFAM
Pfam:NAD_binding_4 27 233 7.1e-14 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173522
AA Change: N46K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133782
Gene: ENSMUSG00000034308
AA Change: N46K

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 208 2.4e-13 PFAM
Pfam:Polysacc_synt_2 11 129 5.2e-11 PFAM
Pfam:Epimerase 11 250 4.3e-28 PFAM
Pfam:GDP_Man_Dehyd 12 273 1.3e-9 PFAM
Pfam:3Beta_HSD 12 285 4.7e-69 PFAM
Pfam:NAD_binding_4 27 233 2.1e-11 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174450
AA Change: N46K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133837
Gene: ENSMUSG00000034308
AA Change: N46K

DomainStartEndE-ValueType
Pfam:adh_short 9 136 1.1e-6 PFAM
Pfam:RmlD_sub_bind 9 184 6.7e-15 PFAM
Pfam:Polysacc_synt_2 11 129 6e-12 PFAM
Pfam:Epimerase 11 176 1.8e-21 PFAM
Pfam:NAD_binding_10 11 189 4.8e-10 PFAM
Pfam:3Beta_HSD 12 189 5.4e-43 PFAM
Pfam:NAD_binding_4 25 186 6.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,267,731 T648S possibly damaging Het
Abca12 T A 1: 71,319,899 I583F probably benign Het
Abca4 A T 3: 122,155,277 M1732L probably benign Het
Ank2 A G 3: 126,946,749 S1742P unknown Het
Birc6 G A 17: 74,662,780 A4273T probably damaging Het
Chd5 A G 4: 152,379,423 T1450A probably damaging Het
Dhx32 T C 7: 133,737,391 N305S probably benign Het
Dnah7c T C 1: 46,659,429 S2174P probably damaging Het
Fam57b G A 7: 126,824,103 V6M probably benign Het
Fat2 T A 11: 55,270,275 I3210F probably benign Het
Gm12888 A G 4: 121,324,797 S33P probably damaging Het
Gpaa1 T C 15: 76,333,238 L292P probably damaging Het
Gzmg T A 14: 56,158,296 R69W probably damaging Het
Hat1 A G 2: 71,409,003 D40G probably damaging Het
Hcrtr2 T A 9: 76,232,921 I362F probably damaging Het
Hmmr T C 11: 40,707,435 E650G probably damaging Het
Ifi35 A T 11: 101,457,782 M180L probably benign Het
Ifi44 A T 3: 151,745,982 H162Q probably benign Het
Il1rl2 T C 1: 40,365,311 F531L probably damaging Het
Ipcef1 T G 10: 6,920,007 K182T probably benign Het
Med27 C A 2: 29,524,364 probably null Het
Med31 G A 11: 72,215,468 probably benign Het
Moxd1 A G 10: 24,223,802 T67A probably benign Het
Myh3 A G 11: 67,095,022 E1266G probably damaging Het
Nkx2-4 C A 2: 147,084,004 E313* probably null Het
Nol6 G T 4: 41,120,168 R487S probably benign Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr470 A G 7: 107,845,161 S191P probably damaging Het
Olfr56 C A 11: 49,134,480 A96D probably benign Het
Olfr726 C T 14: 50,083,872 V270I noncoding transcript Het
Rnf135 A G 11: 80,193,887 D162G probably benign Het
Skor2 T C 18: 76,858,969 S129P unknown Het
Slc7a11 A T 3: 50,427,728 I190N probably damaging Het
Smc5 A T 19: 23,208,926 F1056I Het
Son A T 16: 91,664,936 Q2243L unknown Het
Sult1a1 T A 7: 126,675,108 I101F possibly damaging Het
Sult3a2 T C 10: 33,779,751 I77M probably benign Het
Tas1r1 A T 4: 152,032,317 S287T probably benign Het
Thbs3 A C 3: 89,225,258 T836P probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfrsf8 A T 4: 145,315,083 M1K probably null Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Vmn1r179 C T 7: 23,929,011 A209V probably benign Het
Wdr31 A T 4: 62,463,397 S66T probably benign Het
Zbtb18 T C 1: 177,447,437 V121A probably damaging Het
Zfp30 T A 7: 29,789,401 M82K probably benign Het
Zzef1 A G 11: 72,875,129 Q1494R probably benign Het
Other mutations in Sdr42e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Sdr42e1 APN 8 117663443 missense probably damaging 1.00
IGL01613:Sdr42e1 APN 8 117662937 missense probably benign 0.14
PIT4581001:Sdr42e1 UTSW 8 117663518 missense probably damaging 0.99
R0194:Sdr42e1 UTSW 8 117663109 missense probably damaging 1.00
R1055:Sdr42e1 UTSW 8 117663584 missense probably damaging 0.98
R2108:Sdr42e1 UTSW 8 117665024 missense probably damaging 0.99
R2176:Sdr42e1 UTSW 8 117662877 missense possibly damaging 0.63
R2907:Sdr42e1 UTSW 8 117662772 missense probably damaging 0.99
R4551:Sdr42e1 UTSW 8 117663608 missense probably benign 0.01
R4651:Sdr42e1 UTSW 8 117663621 missense probably benign 0.01
R5148:Sdr42e1 UTSW 8 117663603 missense probably damaging 1.00
R5240:Sdr42e1 UTSW 8 117663282 missense probably benign 0.00
R6242:Sdr42e1 UTSW 8 117663197 missense possibly damaging 0.87
R7417:Sdr42e1 UTSW 8 117662751 missense probably benign 0.04
R7716:Sdr42e1 UTSW 8 117673647 start gained probably benign
R7995:Sdr42e1 UTSW 8 117663268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGATGTTCTCTGTGCCAC -3'
(R):5'- CCTGTAGCGATGAATATGCTAAGTG -3'

Sequencing Primer
(F):5'- GTGCCACCCACGTTGAC -3'
(R):5'- CGATGAATATGCTAAGTGACTCAG -3'
Posted On2020-07-28