Incidental Mutation 'R8255:Myh3'
ID640617
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R8255 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67095022 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1266 (E1266G)
Ref Sequence ENSEMBL: ENSMUSP00000007301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably damaging
Transcript: ENSMUST00000007301
AA Change: E1266G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: E1266G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108689
AA Change: E1266G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: E1266G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165221
AA Change: E1266G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: E1266G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,267,731 T648S possibly damaging Het
Abca12 T A 1: 71,319,899 I583F probably benign Het
Abca4 A T 3: 122,155,277 M1732L probably benign Het
Ank2 A G 3: 126,946,749 S1742P unknown Het
Birc6 G A 17: 74,662,780 A4273T probably damaging Het
Chd5 A G 4: 152,379,423 T1450A probably damaging Het
Dhx32 T C 7: 133,737,391 N305S probably benign Het
Dnah7c T C 1: 46,659,429 S2174P probably damaging Het
Fam57b G A 7: 126,824,103 V6M probably benign Het
Fat2 T A 11: 55,270,275 I3210F probably benign Het
Gm12888 A G 4: 121,324,797 S33P probably damaging Het
Gpaa1 T C 15: 76,333,238 L292P probably damaging Het
Gzmg T A 14: 56,158,296 R69W probably damaging Het
Hat1 A G 2: 71,409,003 D40G probably damaging Het
Hcrtr2 T A 9: 76,232,921 I362F probably damaging Het
Hmmr T C 11: 40,707,435 E650G probably damaging Het
Ifi35 A T 11: 101,457,782 M180L probably benign Het
Ifi44 A T 3: 151,745,982 H162Q probably benign Het
Il1rl2 T C 1: 40,365,311 F531L probably damaging Het
Ipcef1 T G 10: 6,920,007 K182T probably benign Het
Med27 C A 2: 29,524,364 probably null Het
Med31 G A 11: 72,215,468 probably benign Het
Moxd1 A G 10: 24,223,802 T67A probably benign Het
Nkx2-4 C A 2: 147,084,004 E313* probably null Het
Nol6 G T 4: 41,120,168 R487S probably benign Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr470 A G 7: 107,845,161 S191P probably damaging Het
Olfr56 C A 11: 49,134,480 A96D probably benign Het
Olfr726 C T 14: 50,083,872 V270I noncoding transcript Het
Rnf135 A G 11: 80,193,887 D162G probably benign Het
Sdr42e1 G T 8: 117,663,763 N46K probably benign Het
Skor2 T C 18: 76,858,969 S129P unknown Het
Slc7a11 A T 3: 50,427,728 I190N probably damaging Het
Smc5 A T 19: 23,208,926 F1056I Het
Son A T 16: 91,664,936 Q2243L unknown Het
Sult1a1 T A 7: 126,675,108 I101F possibly damaging Het
Sult3a2 T C 10: 33,779,751 I77M probably benign Het
Tas1r1 A T 4: 152,032,317 S287T probably benign Het
Thbs3 A C 3: 89,225,258 T836P probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfrsf8 A T 4: 145,315,083 M1K probably null Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Vmn1r179 C T 7: 23,929,011 A209V probably benign Het
Wdr31 A T 4: 62,463,397 S66T probably benign Het
Zbtb18 T C 1: 177,447,437 V121A probably damaging Het
Zfp30 T A 7: 29,789,401 M82K probably benign Het
Zzef1 A G 11: 72,875,129 Q1494R probably benign Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGAGTTCTTGAAGCTGCGC -3'
(R):5'- ACATTCTCTCCCCGCAAAGG -3'

Sequencing Primer
(F):5'- AAGCTGGAGATTGACGACCTCTC -3'
(R):5'- GGTGCTGCCCTTAGGAGG -3'
Posted On2020-07-28