Incidental Mutation 'R8255:Smc5'
ID640630
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8255 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23208926 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1056 (F1056I)
Ref Sequence ENSEMBL: ENSMUSP00000084837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556]
Predicted Effect
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: F1056I

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,267,731 T648S possibly damaging Het
Abca12 T A 1: 71,319,899 I583F probably benign Het
Abca4 A T 3: 122,155,277 M1732L probably benign Het
Ank2 A G 3: 126,946,749 S1742P unknown Het
Birc6 G A 17: 74,662,780 A4273T probably damaging Het
Chd5 A G 4: 152,379,423 T1450A probably damaging Het
Dhx32 T C 7: 133,737,391 N305S probably benign Het
Dnah7c T C 1: 46,659,429 S2174P probably damaging Het
Fam57b G A 7: 126,824,103 V6M probably benign Het
Fat2 T A 11: 55,270,275 I3210F probably benign Het
Gm12888 A G 4: 121,324,797 S33P probably damaging Het
Gpaa1 T C 15: 76,333,238 L292P probably damaging Het
Gzmg T A 14: 56,158,296 R69W probably damaging Het
Hat1 A G 2: 71,409,003 D40G probably damaging Het
Hcrtr2 T A 9: 76,232,921 I362F probably damaging Het
Hmmr T C 11: 40,707,435 E650G probably damaging Het
Ifi35 A T 11: 101,457,782 M180L probably benign Het
Ifi44 A T 3: 151,745,982 H162Q probably benign Het
Il1rl2 T C 1: 40,365,311 F531L probably damaging Het
Ipcef1 T G 10: 6,920,007 K182T probably benign Het
Med27 C A 2: 29,524,364 probably null Het
Med31 G A 11: 72,215,468 probably benign Het
Moxd1 A G 10: 24,223,802 T67A probably benign Het
Myh3 A G 11: 67,095,022 E1266G probably damaging Het
Nkx2-4 C A 2: 147,084,004 E313* probably null Het
Nol6 G T 4: 41,120,168 R487S probably benign Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr470 A G 7: 107,845,161 S191P probably damaging Het
Olfr56 C A 11: 49,134,480 A96D probably benign Het
Olfr726 C T 14: 50,083,872 V270I noncoding transcript Het
Rnf135 A G 11: 80,193,887 D162G probably benign Het
Sdr42e1 G T 8: 117,663,763 N46K probably benign Het
Skor2 T C 18: 76,858,969 S129P unknown Het
Slc7a11 A T 3: 50,427,728 I190N probably damaging Het
Son A T 16: 91,664,936 Q2243L unknown Het
Sult1a1 T A 7: 126,675,108 I101F possibly damaging Het
Sult3a2 T C 10: 33,779,751 I77M probably benign Het
Tas1r1 A T 4: 152,032,317 S287T probably benign Het
Thbs3 A C 3: 89,225,258 T836P probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnfrsf8 A T 4: 145,315,083 M1K probably null Het
Vmn1r121 T G 7: 21,097,754 N254H probably benign Het
Vmn1r179 C T 7: 23,929,011 A209V probably benign Het
Wdr31 A T 4: 62,463,397 S66T probably benign Het
Zbtb18 T C 1: 177,447,437 V121A probably damaging Het
Zfp30 T A 7: 29,789,401 M82K probably benign Het
Zzef1 A G 11: 72,875,129 Q1494R probably benign Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
R7990:Smc5 UTSW 19 23235882 missense probably benign 0.01
R8359:Smc5 UTSW 19 23234079 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTTTTATTCACTTGAGCGAGCG -3'
(R):5'- TAAATAGAGAGGATTTCCGGGC -3'

Sequencing Primer
(F):5'- TTGAGCGAGCGACACATATAAAC -3'
(R):5'- TCAGTAATTAGGCCAGGCTTCAG -3'
Posted On2020-07-28