Incidental Mutation 'R8254:Vmn2r72'
ID640652
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8254 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85751019 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 274 (D274G)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: D274G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: D274G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,349 V1119A possibly damaging Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Arhgef2 T C 3: 88,642,603 L655P probably damaging Het
Brsk2 T C 7: 141,984,416 S100P probably damaging Het
Calb1 A G 4: 15,898,926 T141A probably benign Het
Cog6 T C 3: 52,993,517 T447A probably benign Het
Cyp4f13 A T 17: 32,929,933 N279K probably benign Het
Dnah11 T C 12: 117,878,524 D4440G possibly damaging Het
Dspp A T 5: 104,175,328 E112D possibly damaging Het
Fam3c T A 6: 22,328,676 T71S possibly damaging Het
Fdxr C A 11: 115,271,318 G188W probably damaging Het
Fndc5 T C 4: 129,138,721 V39A possibly damaging Het
Gm14226 T C 2: 155,024,726 I201T possibly damaging Het
Gm853 C A 4: 130,220,343 A94S probably benign Het
Grip1 C T 10: 120,054,905 Q950* probably null Het
Gsg2 A T 11: 73,136,746 Y506N probably benign Het
Itga2b C A 11: 102,467,386 R171L probably benign Het
Kctd2 C T 11: 115,420,348 P61S unknown Het
Kirrel2 A G 7: 30,450,376 probably null Het
Lmx1b A G 2: 33,565,114 F310S Het
Map4k4 A T 1: 40,006,675 I574F probably damaging Het
Nrip1 T C 16: 76,291,399 K1090R probably benign Het
Ntrk3 T C 7: 78,192,578 Y820C probably damaging Het
Olfr1446 T C 19: 12,890,485 T31A probably benign Het
Olfr209 T A 16: 59,362,171 I16L probably benign Het
Pcdhb11 T C 18: 37,422,189 Y191H probably benign Het
Pgm5 T C 19: 24,727,725 K475E probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psd4 A T 2: 24,403,211 D696V probably damaging Het
Rere T C 4: 150,612,672 F556L unknown Het
Sema4f A T 6: 82,917,401 C528S probably damaging Het
Sorcs2 A G 5: 36,038,206 S680P probably benign Het
Sv2c T C 13: 96,088,565 T79A probably damaging Het
Tarsl2 A G 7: 65,676,061 N461S probably benign Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tubd1 A T 11: 86,549,438 Q96L probably damaging Het
Vps13d A T 4: 144,983,312 probably benign Het
Vwce C A 19: 10,650,574 S466Y probably damaging Het
Wdr11 T C 7: 129,634,836 I1178T probably benign Het
Zfp568 A T 7: 30,015,133 H145L probably benign Het
Zfp606 T C 7: 12,492,861 I303T possibly damaging Het
Zfp846 A G 9: 20,593,291 D149G probably benign Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAGATATTTCGGGTTTCTGG -3'
(R):5'- CATGGTGTCCCTAATGGTTCATTTC -3'

Sequencing Primer
(F):5'- GTGACACACTAACCCAGAT -3'
(R):5'- GCGATGATTACAAATGATGACCATG -3'
Posted On2020-07-28