Incidental Mutation 'R8254:Zfp846'
ID640655
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Namezinc finger protein 846
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8254 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20581291-20605409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20593291 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
Predicted Effect probably benign
Transcript: ENSMUST00000060063
AA Change: D149G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: D149G

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115557
AA Change: D149G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: D149G

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,349 V1119A possibly damaging Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Arhgef2 T C 3: 88,642,603 L655P probably damaging Het
Brsk2 T C 7: 141,984,416 S100P probably damaging Het
Calb1 A G 4: 15,898,926 T141A probably benign Het
Cog6 T C 3: 52,993,517 T447A probably benign Het
Cyp4f13 A T 17: 32,929,933 N279K probably benign Het
Dnah11 T C 12: 117,878,524 D4440G possibly damaging Het
Dspp A T 5: 104,175,328 E112D possibly damaging Het
Fam3c T A 6: 22,328,676 T71S possibly damaging Het
Fdxr C A 11: 115,271,318 G188W probably damaging Het
Fndc5 T C 4: 129,138,721 V39A possibly damaging Het
Gm14226 T C 2: 155,024,726 I201T possibly damaging Het
Gm853 C A 4: 130,220,343 A94S probably benign Het
Grip1 C T 10: 120,054,905 Q950* probably null Het
Gsg2 A T 11: 73,136,746 Y506N probably benign Het
Itga2b C A 11: 102,467,386 R171L probably benign Het
Kctd2 C T 11: 115,420,348 P61S unknown Het
Kirrel2 A G 7: 30,450,376 probably null Het
Lmx1b A G 2: 33,565,114 F310S Het
Map4k4 A T 1: 40,006,675 I574F probably damaging Het
Nrip1 T C 16: 76,291,399 K1090R probably benign Het
Ntrk3 T C 7: 78,192,578 Y820C probably damaging Het
Olfr1446 T C 19: 12,890,485 T31A probably benign Het
Olfr209 T A 16: 59,362,171 I16L probably benign Het
Pcdhb11 T C 18: 37,422,189 Y191H probably benign Het
Pgm5 T C 19: 24,727,725 K475E probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psd4 A T 2: 24,403,211 D696V probably damaging Het
Rere T C 4: 150,612,672 F556L unknown Het
Sema4f A T 6: 82,917,401 C528S probably damaging Het
Sorcs2 A G 5: 36,038,206 S680P probably benign Het
Sv2c T C 13: 96,088,565 T79A probably damaging Het
Tarsl2 A G 7: 65,676,061 N461S probably benign Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tubd1 A T 11: 86,549,438 Q96L probably damaging Het
Vmn2r72 T C 7: 85,751,019 D274G probably damaging Het
Vps13d A T 4: 144,983,312 probably benign Het
Vwce C A 19: 10,650,574 S466Y probably damaging Het
Wdr11 T C 7: 129,634,836 I1178T probably benign Het
Zfp568 A T 7: 30,015,133 H145L probably benign Het
Zfp606 T C 7: 12,492,861 I303T possibly damaging Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20588609 missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20588500 splice site probably benign
R0077:Zfp846 UTSW 9 20594007 missense probably benign 0.00
R0528:Zfp846 UTSW 9 20587928 splice site probably benign
R0675:Zfp846 UTSW 9 20593557 missense probably benign
R1116:Zfp846 UTSW 9 20593263 missense possibly damaging 0.96
R1439:Zfp846 UTSW 9 20594097 missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20594439 missense probably benign
R4586:Zfp846 UTSW 9 20593513 missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20590815 missense probably benign
R6221:Zfp846 UTSW 9 20593295 missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20593720 missense possibly damaging 0.93
R6420:Zfp846 UTSW 9 20593711 missense probably damaging 1.00
R6526:Zfp846 UTSW 9 20593871 missense probably benign 0.23
R7003:Zfp846 UTSW 9 20587892 start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20594225 missense probably benign 0.00
R7651:Zfp846 UTSW 9 20588512 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTCCTGCTTATAGTCAAAATGGC -3'
(R):5'- ATATGCTGACTAAGGCGTGG -3'

Sequencing Primer
(F):5'- CTGCTTATAGTCAAAATGGCAAAATC -3'
(R):5'- AGTTATAAGGCCTGACCGCTTAGC -3'
Posted On2020-07-28