Incidental Mutation 'R8254:Zfp846'
ID 640655
Institutional Source Beutler Lab
Gene Symbol Zfp846
Ensembl Gene ENSMUSG00000058192
Gene Name zinc finger protein 846
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8254 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 20581291-20605409 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20593291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000111219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060063] [ENSMUST00000115557] [ENSMUST00000140668]
AlphaFold G3X996
Predicted Effect probably benign
Transcript: ENSMUST00000060063
AA Change: D149G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051593
Gene: ENSMUSG00000058192
AA Change: D149G

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115557
AA Change: D149G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111219
Gene: ENSMUSG00000058192
AA Change: D149G

DomainStartEndE-ValueType
KRAB 14 74 5.69e-28 SMART
ZnF_C2H2 113 137 1.02e1 SMART
ZnF_C2H2 162 184 8.6e-5 SMART
ZnF_C2H2 190 212 1.3e-4 SMART
ZnF_C2H2 218 240 1.12e-3 SMART
ZnF_C2H2 246 268 5.21e-4 SMART
ZnF_C2H2 274 297 9.58e-3 SMART
ZnF_C2H2 303 325 7.49e-5 SMART
ZnF_C2H2 331 354 2.95e-3 SMART
ZnF_C2H2 360 382 4.47e-3 SMART
ZnF_C2H2 388 410 4.11e-2 SMART
ZnF_C2H2 416 438 1.03e-2 SMART
ZnF_C2H2 444 466 5.21e-4 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140668
SMART Domains Protein: ENSMUSP00000115945
Gene: ENSMUSG00000058192

DomainStartEndE-ValueType
KRAB 14 67 1.99e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,349 V1119A possibly damaging Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Arhgef2 T C 3: 88,642,603 L655P probably damaging Het
Brsk2 T C 7: 141,984,416 S100P probably damaging Het
Calb1 A G 4: 15,898,926 T141A probably benign Het
Cog6 T C 3: 52,993,517 T447A probably benign Het
Cyp4f13 A T 17: 32,929,933 N279K probably benign Het
Dnah11 T C 12: 117,878,524 D4440G possibly damaging Het
Dspp A T 5: 104,175,328 E112D possibly damaging Het
Fam3c T A 6: 22,328,676 T71S possibly damaging Het
Fdxr C A 11: 115,271,318 G188W probably damaging Het
Fndc5 T C 4: 129,138,721 V39A possibly damaging Het
Gm14226 T C 2: 155,024,726 I201T possibly damaging Het
Gm853 C A 4: 130,220,343 A94S probably benign Het
Grip1 C T 10: 120,054,905 Q950* probably null Het
Gsg2 A T 11: 73,136,746 Y506N probably benign Het
Itga2b C A 11: 102,467,386 R171L probably benign Het
Kctd2 C T 11: 115,420,348 P61S unknown Het
Kirrel2 A G 7: 30,450,376 probably null Het
Lmx1b A G 2: 33,565,114 F310S Het
Map4k4 A T 1: 40,006,675 I574F probably damaging Het
Nrip1 T C 16: 76,291,399 K1090R probably benign Het
Ntrk3 T C 7: 78,192,578 Y820C probably damaging Het
Olfr1446 T C 19: 12,890,485 T31A probably benign Het
Olfr209 T A 16: 59,362,171 I16L probably benign Het
Pcdhb11 T C 18: 37,422,189 Y191H probably benign Het
Pgm5 T C 19: 24,727,725 K475E probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psd4 A T 2: 24,403,211 D696V probably damaging Het
Rere T C 4: 150,612,672 F556L unknown Het
Sema4f A T 6: 82,917,401 C528S probably damaging Het
Sorcs2 A G 5: 36,038,206 S680P probably benign Het
Sv2c T C 13: 96,088,565 T79A probably damaging Het
Tarsl2 A G 7: 65,676,061 N461S probably benign Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tubd1 A T 11: 86,549,438 Q96L probably damaging Het
Vmn2r72 T C 7: 85,751,019 D274G probably damaging Het
Vps13d A T 4: 144,983,312 probably benign Het
Vwce C A 19: 10,650,574 S466Y probably damaging Het
Wdr11 T C 7: 129,634,836 I1178T probably benign Het
Zfp568 A T 7: 30,015,133 H145L probably benign Het
Zfp606 T C 7: 12,492,861 I303T possibly damaging Het
Other mutations in Zfp846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Zfp846 APN 9 20588609 missense probably damaging 1.00
IGL02440:Zfp846 APN 9 20588500 splice site probably benign
R0077:Zfp846 UTSW 9 20594007 missense probably benign 0.00
R0528:Zfp846 UTSW 9 20587928 splice site probably benign
R0675:Zfp846 UTSW 9 20593557 missense probably benign
R1116:Zfp846 UTSW 9 20593263 missense possibly damaging 0.96
R1439:Zfp846 UTSW 9 20594097 missense possibly damaging 0.83
R3803:Zfp846 UTSW 9 20594439 missense probably benign
R4586:Zfp846 UTSW 9 20593513 missense probably damaging 0.96
R4872:Zfp846 UTSW 9 20590815 missense probably benign
R6221:Zfp846 UTSW 9 20593295 missense possibly damaging 0.53
R6416:Zfp846 UTSW 9 20593720 missense possibly damaging 0.93
R6420:Zfp846 UTSW 9 20593711 missense probably damaging 1.00
R6526:Zfp846 UTSW 9 20593871 missense probably benign 0.23
R7003:Zfp846 UTSW 9 20587892 start codon destroyed probably null 0.99
R7332:Zfp846 UTSW 9 20594225 missense probably benign 0.00
R7651:Zfp846 UTSW 9 20588512 missense possibly damaging 0.86
R8724:Zfp846 UTSW 9 20594056 missense possibly damaging 0.88
R8997:Zfp846 UTSW 9 20594430 missense probably benign 0.41
R9045:Zfp846 UTSW 9 20593893 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCTGCTTATAGTCAAAATGGC -3'
(R):5'- ATATGCTGACTAAGGCGTGG -3'

Sequencing Primer
(F):5'- CTGCTTATAGTCAAAATGGCAAAATC -3'
(R):5'- AGTTATAAGGCCTGACCGCTTAGC -3'
Posted On 2020-07-28