Incidental Mutation 'R8254:Sv2c'
ID 640663
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 067680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8254 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96225073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 79 (T79A)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably damaging
Transcript: ENSMUST00000161263
AA Change: T79A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: T79A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182289
AA Change: T79A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: T79A

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,182,760 (GRCm39) Y236C probably benign Het
Arhgef2 T C 3: 88,549,910 (GRCm39) L655P probably damaging Het
Brsk2 T C 7: 141,538,153 (GRCm39) S100P probably damaging Het
Calb1 A G 4: 15,898,926 (GRCm39) T141A probably benign Het
Cog6 T C 3: 52,900,938 (GRCm39) T447A probably benign Het
Cyp4f13 A T 17: 33,148,907 (GRCm39) N279K probably benign Het
Dnah11 T C 12: 117,842,259 (GRCm39) D4440G possibly damaging Het
Dspp A T 5: 104,323,194 (GRCm39) E112D possibly damaging Het
Fam3c T A 6: 22,328,675 (GRCm39) T71S possibly damaging Het
Fcgbpl1 T C 7: 27,846,774 (GRCm39) V1119A possibly damaging Het
Fdxr C A 11: 115,162,144 (GRCm39) G188W probably damaging Het
Fndc5 T C 4: 129,032,514 (GRCm39) V39A possibly damaging Het
Gm14226 T C 2: 154,866,646 (GRCm39) I201T possibly damaging Het
Grip1 C T 10: 119,890,810 (GRCm39) Q950* probably null Het
Haspin A T 11: 73,027,572 (GRCm39) Y506N probably benign Het
Itga2b C A 11: 102,358,212 (GRCm39) R171L probably benign Het
Kctd2 C T 11: 115,311,174 (GRCm39) P61S unknown Het
Kirrel2 A G 7: 30,149,801 (GRCm39) probably null Het
Ldc1 C A 4: 130,114,136 (GRCm39) A94S probably benign Het
Lmx1b A G 2: 33,455,126 (GRCm39) F310S Het
Map4k4 A T 1: 40,045,835 (GRCm39) I574F probably damaging Het
Nrip1 T C 16: 76,088,287 (GRCm39) K1090R probably benign Het
Ntrk3 T C 7: 77,842,326 (GRCm39) Y820C probably damaging Het
Or5ac25 T A 16: 59,182,534 (GRCm39) I16L probably benign Het
Or5b96 T C 19: 12,867,849 (GRCm39) T31A probably benign Het
Pcdhb11 T C 18: 37,555,242 (GRCm39) Y191H probably benign Het
Pgm5 T C 19: 24,705,089 (GRCm39) K475E probably benign Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Psd4 A T 2: 24,293,223 (GRCm39) D696V probably damaging Het
Rere T C 4: 150,697,129 (GRCm39) F556L unknown Het
Sema4f A T 6: 82,894,382 (GRCm39) C528S probably damaging Het
Sorcs2 A G 5: 36,195,550 (GRCm39) S680P probably benign Het
Tars3 A G 7: 65,325,809 (GRCm39) N461S probably benign Het
Thada T C 17: 84,533,468 (GRCm39) N1661S probably benign Het
Tubd1 A T 11: 86,440,264 (GRCm39) Q96L probably damaging Het
Vmn2r72 T C 7: 85,400,227 (GRCm39) D274G probably damaging Het
Vps13d A T 4: 144,709,882 (GRCm39) probably benign Het
Vwce C A 19: 10,627,938 (GRCm39) S466Y probably damaging Het
Wdr11 T C 7: 129,236,560 (GRCm39) I1178T probably benign Het
Zfp568 A T 7: 29,714,558 (GRCm39) H145L probably benign Het
Zfp606 T C 7: 12,226,788 (GRCm39) I303T possibly damaging Het
Zfp846 A G 9: 20,504,587 (GRCm39) D149G probably benign Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCACACTCTTGGATTATCAGC -3'
(R):5'- AAGGGTGCCAAGGACATTGC -3'

Sequencing Primer
(F):5'- ACTCTTGGATTATCAGCTCATACTG -3'
(R):5'- TGCCAAGGACATTGCCAAAG -3'
Posted On 2020-07-28