Incidental Mutation 'R8254:Cyp4f13'
ID640668
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8254 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32924688-32947402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32929933 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 279 (N279K)
Ref Sequence ENSEMBL: ENSMUSP00000074733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353] [ENSMUST00000141325] [ENSMUST00000145683]
Predicted Effect probably benign
Transcript: ENSMUST00000075253
AA Change: N279K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: N279K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139353
AA Change: N170K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055
AA Change: N170K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141325
SMART Domains Protein: ENSMUSP00000117168
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145683
SMART Domains Protein: ENSMUSP00000118919
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,349 V1119A possibly damaging Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Arhgef2 T C 3: 88,642,603 L655P probably damaging Het
Brsk2 T C 7: 141,984,416 S100P probably damaging Het
Calb1 A G 4: 15,898,926 T141A probably benign Het
Cog6 T C 3: 52,993,517 T447A probably benign Het
Dnah11 T C 12: 117,878,524 D4440G possibly damaging Het
Dspp A T 5: 104,175,328 E112D possibly damaging Het
Fam3c T A 6: 22,328,676 T71S possibly damaging Het
Fdxr C A 11: 115,271,318 G188W probably damaging Het
Fndc5 T C 4: 129,138,721 V39A possibly damaging Het
Gm14226 T C 2: 155,024,726 I201T possibly damaging Het
Gm853 C A 4: 130,220,343 A94S probably benign Het
Grip1 C T 10: 120,054,905 Q950* probably null Het
Gsg2 A T 11: 73,136,746 Y506N probably benign Het
Itga2b C A 11: 102,467,386 R171L probably benign Het
Kctd2 C T 11: 115,420,348 P61S unknown Het
Kirrel2 A G 7: 30,450,376 probably null Het
Lmx1b A G 2: 33,565,114 F310S Het
Map4k4 A T 1: 40,006,675 I574F probably damaging Het
Nrip1 T C 16: 76,291,399 K1090R probably benign Het
Ntrk3 T C 7: 78,192,578 Y820C probably damaging Het
Olfr1446 T C 19: 12,890,485 T31A probably benign Het
Olfr209 T A 16: 59,362,171 I16L probably benign Het
Pcdhb11 T C 18: 37,422,189 Y191H probably benign Het
Pgm5 T C 19: 24,727,725 K475E probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psd4 A T 2: 24,403,211 D696V probably damaging Het
Rere T C 4: 150,612,672 F556L unknown Het
Sema4f A T 6: 82,917,401 C528S probably damaging Het
Sorcs2 A G 5: 36,038,206 S680P probably benign Het
Sv2c T C 13: 96,088,565 T79A probably damaging Het
Tarsl2 A G 7: 65,676,061 N461S probably benign Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tubd1 A T 11: 86,549,438 Q96L probably damaging Het
Vmn2r72 T C 7: 85,751,019 D274G probably damaging Het
Vps13d A T 4: 144,983,312 probably benign Het
Vwce C A 19: 10,650,574 S466Y probably damaging Het
Wdr11 T C 7: 129,634,836 I1178T probably benign Het
Zfp568 A T 7: 30,015,133 H145L probably benign Het
Zfp606 T C 7: 12,492,861 I303T possibly damaging Het
Zfp846 A G 9: 20,593,291 D149G probably benign Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0220:Cyp4f13 UTSW 17 32929502 missense probably damaging 1.00
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R0357:Cyp4f13 UTSW 17 32932651 nonsense probably null
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5310:Cyp4f13 UTSW 17 32925821 missense probably damaging 1.00
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
R8495:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8496:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8498:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATTCAGCAGAGCTACCTC -3'
(R):5'- TGCAATCCTGGAACTTAGCTCC -3'

Sequencing Primer
(F):5'- TACAGTCACCATCTATGTCTCACTAG -3'
(R):5'- AGCTCCCTTGTAGTGAAACG -3'
Posted On2020-07-28