Incidental Mutation 'R8254:Olfr1446'
ID640672
Institutional Source Beutler Lab
Gene Symbol Olfr1446
Ensembl Gene ENSMUSG00000057817
Gene Nameolfactory receptor 1446
SynonymsGA_x6K02T2RE5P-3220047-3219130, MOR202-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8254 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12888266-12893524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12890485 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 31 (T31A)
Ref Sequence ENSEMBL: ENSMUSP00000079994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081236] [ENSMUST00000207741]
Predicted Effect probably benign
Transcript: ENSMUST00000081236
AA Change: T31A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000079994
Gene: ENSMUSG00000057817
AA Change: T31A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 5.1e-6 PFAM
Pfam:7tm_1 42 291 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207319
AA Change: T31A
Predicted Effect probably benign
Transcript: ENSMUST00000207741
AA Change: T31A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,349 V1119A possibly damaging Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Arhgef2 T C 3: 88,642,603 L655P probably damaging Het
Brsk2 T C 7: 141,984,416 S100P probably damaging Het
Calb1 A G 4: 15,898,926 T141A probably benign Het
Cog6 T C 3: 52,993,517 T447A probably benign Het
Cyp4f13 A T 17: 32,929,933 N279K probably benign Het
Dnah11 T C 12: 117,878,524 D4440G possibly damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dspp A T 5: 104,175,328 E112D possibly damaging Het
Fam3c T A 6: 22,328,676 T71S possibly damaging Het
Fdxr C A 11: 115,271,318 G188W probably damaging Het
Fndc5 T C 4: 129,138,721 V39A possibly damaging Het
Gm14226 T C 2: 155,024,726 I201T possibly damaging Het
Gm853 C A 4: 130,220,343 A94S probably benign Het
Grip1 C T 10: 120,054,905 Q950* probably null Het
Gsg2 A T 11: 73,136,746 Y506N probably benign Het
Itga2b C A 11: 102,467,386 R171L probably benign Het
Kctd2 C T 11: 115,420,348 P61S unknown Het
Kirrel2 A G 7: 30,450,376 probably null Het
Lmx1b A G 2: 33,565,114 F310S Het
Map4k4 A T 1: 40,006,675 I574F probably damaging Het
Nrip1 T C 16: 76,291,399 K1090R probably benign Het
Ntrk3 T C 7: 78,192,578 Y820C probably damaging Het
Olfr209 T A 16: 59,362,171 I16L probably benign Het
Pcdhb11 T C 18: 37,422,189 Y191H probably benign Het
Pgm5 T C 19: 24,727,725 K475E probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psd4 A T 2: 24,403,211 D696V probably damaging Het
Rere T C 4: 150,612,672 F556L unknown Het
Sema4f A T 6: 82,917,401 C528S probably damaging Het
Sorcs2 A G 5: 36,038,206 S680P probably benign Het
Sv2c T C 13: 96,088,565 T79A probably damaging Het
Tarsl2 A G 7: 65,676,061 N461S probably benign Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tubd1 A T 11: 86,549,438 Q96L probably damaging Het
Vmn2r72 T C 7: 85,751,019 D274G probably damaging Het
Vwce C A 19: 10,650,574 S466Y probably damaging Het
Wdr11 T C 7: 129,634,836 I1178T probably benign Het
Zfp568 A T 7: 30,015,133 H145L probably benign Het
Zfp606 T C 7: 12,492,861 I303T possibly damaging Het
Zfp846 A G 9: 20,593,291 D149G probably benign Het
Other mutations in Olfr1446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Olfr1446 APN 19 12889918 missense probably benign 0.00
IGL01399:Olfr1446 APN 19 12890439 missense probably benign 0.28
IGL01697:Olfr1446 APN 19 12890467 missense probably benign 0.24
IGL01739:Olfr1446 APN 19 12890149 missense probably benign 0.02
IGL01894:Olfr1446 APN 19 12889643 utr 3 prime probably benign
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R0164:Olfr1446 UTSW 19 12890445 missense probably damaging 1.00
R1163:Olfr1446 UTSW 19 12890149 missense probably benign 0.02
R1769:Olfr1446 UTSW 19 12889683 missense probably damaging 1.00
R4406:Olfr1446 UTSW 19 12890234 nonsense probably null
R5038:Olfr1446 UTSW 19 12890406 missense probably damaging 1.00
R5207:Olfr1446 UTSW 19 12890437 missense probably benign 0.28
R5627:Olfr1446 UTSW 19 12890299 missense probably damaging 1.00
R5995:Olfr1446 UTSW 19 12890597 splice site probably null
R7953:Olfr1446 UTSW 19 12889731 missense probably damaging 1.00
R8043:Olfr1446 UTSW 19 12889731 missense probably damaging 1.00
X0062:Olfr1446 UTSW 19 12890563 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GCAGCACAGTCATTGTAGGAAATG -3'
(R):5'- GCCCGCATTATCTTCTGGAATG -3'

Sequencing Primer
(F):5'- TGACAGCTGAGGAGTAAC -3'
(R):5'- CTGGAATGTACAAATACTAGTTGGC -3'
Posted On2020-07-28