Mutagenetix > Incidental Mutation

Incidental Mutation 'R8247:Cntln'

640690

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R8247 (G1)

Quality Score

215.009

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85100780 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 102 (T102A)

Ref Sequence

ENSEMBL: ENSMUSP00000102808 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

probably benign
Transcript: ENSMUST00000047023
AA Change: T1237A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T1237A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107190
AA Change: T102A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: T102A

Domain	Start	End	E-Value	Type
low complexity region	71	82	N/A	INTRINSIC
Blast:HisKA	135	191	8e-27	BLAST
low complexity region	192	213	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169371
AA Change: T1236A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T1236A

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	T	C	6: 52,178,962	S3P	unknown	Het
Abca15	A	T	7: 120,337,222	Y170F	possibly damaging	Het
Alpl	C	T	4: 137,746,453	V313M	probably damaging	Het
Ankrd44	T	C	1: 54,752,943	H311R	probably damaging	Het
Atm	A	T	9: 53,450,570	L2749Q		Het
Bicd2	C	T	13: 49,379,986	R683W	probably damaging	Het
Brat1	C	A	5: 140,713,138	P342T	possibly damaging	Het
Camta1	T	A	4: 151,075,264	T482S	probably damaging	Het
Carhsp1	A	G	16: 8,663,671	V67A	probably damaging	Het
Ccdc126	C	T	6: 49,339,841	T85M	probably damaging	Het
Cd274	C	T	19: 29,385,395	Q286*	probably null	Het
Cep192	T	A	18: 67,841,117	I1097N	probably benign	Het
Clvs1	A	T	4: 9,281,885	N110Y	possibly damaging	Het
Cp	A	C	3: 19,966,406	I188L	possibly damaging	Het
Crh	A	G	3: 19,694,127	L117P	probably benign	Het
Dennd2c	A	G	3: 103,152,321	D521G	probably damaging	Het
E2f2	C	T	4: 136,172,815	T12M	possibly damaging	Het
Eid2	G	A	7: 28,268,547	R198H	probably damaging	Het
Exosc4	G	T	15: 76,329,079	C74F	probably damaging	Het
Fanca	A	T	8: 123,283,955		probably benign	Het
Ganc	A	T	2: 120,436,700	Q499L	probably null	Het
Gfy	T	C	7: 45,178,286	T129A	possibly damaging	Het
Gli3	G	T	13: 15,726,775	M1582I	possibly damaging	Het
Gm4744	A	G	6: 40,949,468	S63P		Het
Htr2b	T	C	1: 86,100,095	T230A	probably benign	Het
Iqcb1	T	A	16: 36,858,474	N383K	probably benign	Het
Lpcat1	A	T	13: 73,513,952	I471F	probably damaging	Het
Lrch3	T	G	16: 33,009,343	L781*	probably null	Het
Lrif1	T	A	3: 106,734,376	S3T	probably damaging	Het
Lrp2	T	A	2: 69,431,087	R4503S	possibly damaging	Het
Lrrc16a	T	A	13: 24,099,015	N512I	probably damaging	Het
Lrrc8c	T	C	5: 105,608,444	I695T	probably damaging	Het
Mak	G	A	13: 41,039,670	T473M	possibly damaging	Het
Map2k5	A	T	9: 63,371,737	Y62N	probably damaging	Het
Mbd3l2	T	C	9: 18,445,003	L208P	probably damaging	Het
Myo18b	T	C	5: 112,692,196	E2577G	probably damaging	Het
Nfia	A	T	4: 98,065,407	T461S	probably benign	Het
Oaz3	A	G	3: 94,436,434	Y41H	probably damaging	Het
Olfr1368	A	G	13: 21,142,125	S311P	probably benign	Het
Olfr509	T	A	7: 108,646,163	I138F	probably damaging	Het
Olfr59	C	A	11: 74,289,489	T281K	noncoding transcript	Het
Olfr631	T	C	7: 103,929,576	V251A	possibly damaging	Het
Pin1rt1	T	C	2: 104,714,547	E80G	probably damaging	Het
Pmpcb	T	C	5: 21,756,854	Y457H	probably damaging	Het
Polr2b	T	C	5: 77,320,215	S121P	possibly damaging	Het
Ppm1e	C	T	11: 87,231,275	G619R	probably benign	Het
Pramel5	T	A	4: 144,272,825	M231L	probably damaging	Het
Prex2	G	T	1: 11,199,970	C1293F	probably benign	Het
Psg20	A	G	7: 18,682,637	F185L	probably benign	Het
Psg28	A	G	7: 18,422,939	V457A	probably benign	Het
Pxmp2	A	G	5: 110,274,579	L188P	probably damaging	Het
Scd3	A	T	19: 44,238,564	N279I	possibly damaging	Het
Scg2	T	G	1: 79,436,519	K162N	possibly damaging	Het
Sipa1l2	T	C	8: 125,422,633	E1629G	probably benign	Het
Slc27a2	T	A	2: 126,553,595	F147L	probably benign	Het
Smco1	T	C	16: 32,273,739	V76A	probably benign	Het
Spic	T	C	10: 88,676,061	K111R	probably damaging	Het
Spidr	A	G	16: 15,968,526		probably null	Het
Sptbn1	T	A	11: 30,113,906	I1971F	possibly damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Tex33	A	C	15: 78,378,792	S221A	probably benign	Het
Tiam1	G	A	16: 89,898,149	T140M	probably benign	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Ufl1	T	C	4: 25,250,606	E749G	probably benign	Het
Vmn1r168	G	T	7: 23,541,062	V115F	possibly damaging	Het
Vprbp	A	T	9: 106,854,228	I635F	possibly damaging	Het
Wars2	G	A	3: 99,187,649	V87I	probably benign	Het
Zdhhc14	T	A	17: 5,685,756	C170S	probably damaging	Het
Zfp113	C	T	5: 138,145,034	C318Y	possibly damaging	Het
Zfp367	A	G	13: 64,152,668	S108P	probably benign	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAAATGAAAGTAGGTTGCACG -3'
(R):5'- AGTGAGGTCGTCTCTATGCAG -3'

Sequencing Primer
(F):5'- GTTGCACGTATAGAACAATGCAGTC -3'
(R):5'- GAGGTCGTCTCTATGCAGTAACATC -3'

Posted On

2020-07-28