Incidental Mutation 'R8247:Cntln'
ID 640690
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R8247 (G1)
Quality Score 215.009
Status Validated
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85100780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 102 (T102A)
Ref Sequence ENSEMBL: ENSMUSP00000102808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: T1237A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T1237A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107190
AA Change: T102A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070
AA Change: T102A

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: T1236A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T1236A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,962 S3P unknown Het
Abca15 A T 7: 120,337,222 Y170F possibly damaging Het
Alpl C T 4: 137,746,453 V313M probably damaging Het
Ankrd44 T C 1: 54,752,943 H311R probably damaging Het
Atm A T 9: 53,450,570 L2749Q Het
Bicd2 C T 13: 49,379,986 R683W probably damaging Het
Brat1 C A 5: 140,713,138 P342T possibly damaging Het
Camta1 T A 4: 151,075,264 T482S probably damaging Het
Carhsp1 A G 16: 8,663,671 V67A probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Cd274 C T 19: 29,385,395 Q286* probably null Het
Cep192 T A 18: 67,841,117 I1097N probably benign Het
Clvs1 A T 4: 9,281,885 N110Y possibly damaging Het
Cp A C 3: 19,966,406 I188L possibly damaging Het
Crh A G 3: 19,694,127 L117P probably benign Het
Dennd2c A G 3: 103,152,321 D521G probably damaging Het
E2f2 C T 4: 136,172,815 T12M possibly damaging Het
Eid2 G A 7: 28,268,547 R198H probably damaging Het
Exosc4 G T 15: 76,329,079 C74F probably damaging Het
Fanca A T 8: 123,283,955 probably benign Het
Ganc A T 2: 120,436,700 Q499L probably null Het
Gfy T C 7: 45,178,286 T129A possibly damaging Het
Gli3 G T 13: 15,726,775 M1582I possibly damaging Het
Gm4744 A G 6: 40,949,468 S63P Het
Htr2b T C 1: 86,100,095 T230A probably benign Het
Iqcb1 T A 16: 36,858,474 N383K probably benign Het
Lpcat1 A T 13: 73,513,952 I471F probably damaging Het
Lrch3 T G 16: 33,009,343 L781* probably null Het
Lrif1 T A 3: 106,734,376 S3T probably damaging Het
Lrp2 T A 2: 69,431,087 R4503S possibly damaging Het
Lrrc16a T A 13: 24,099,015 N512I probably damaging Het
Lrrc8c T C 5: 105,608,444 I695T probably damaging Het
Mak G A 13: 41,039,670 T473M possibly damaging Het
Map2k5 A T 9: 63,371,737 Y62N probably damaging Het
Mbd3l2 T C 9: 18,445,003 L208P probably damaging Het
Myo18b T C 5: 112,692,196 E2577G probably damaging Het
Nfia A T 4: 98,065,407 T461S probably benign Het
Oaz3 A G 3: 94,436,434 Y41H probably damaging Het
Olfr1368 A G 13: 21,142,125 S311P probably benign Het
Olfr509 T A 7: 108,646,163 I138F probably damaging Het
Olfr59 C A 11: 74,289,489 T281K noncoding transcript Het
Olfr631 T C 7: 103,929,576 V251A possibly damaging Het
Pin1rt1 T C 2: 104,714,547 E80G probably damaging Het
Pmpcb T C 5: 21,756,854 Y457H probably damaging Het
Polr2b T C 5: 77,320,215 S121P possibly damaging Het
Ppm1e C T 11: 87,231,275 G619R probably benign Het
Pramel5 T A 4: 144,272,825 M231L probably damaging Het
Prex2 G T 1: 11,199,970 C1293F probably benign Het
Psg20 A G 7: 18,682,637 F185L probably benign Het
Psg28 A G 7: 18,422,939 V457A probably benign Het
Pxmp2 A G 5: 110,274,579 L188P probably damaging Het
Scd3 A T 19: 44,238,564 N279I possibly damaging Het
Scg2 T G 1: 79,436,519 K162N possibly damaging Het
Sipa1l2 T C 8: 125,422,633 E1629G probably benign Het
Slc27a2 T A 2: 126,553,595 F147L probably benign Het
Smco1 T C 16: 32,273,739 V76A probably benign Het
Spic T C 10: 88,676,061 K111R probably damaging Het
Spidr A G 16: 15,968,526 probably null Het
Sptbn1 T A 11: 30,113,906 I1971F possibly damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Tex33 A C 15: 78,378,792 S221A probably benign Het
Tiam1 G A 16: 89,898,149 T140M probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ufl1 T C 4: 25,250,606 E749G probably benign Het
Vmn1r168 G T 7: 23,541,062 V115F possibly damaging Het
Vprbp A T 9: 106,854,228 I635F possibly damaging Het
Wars2 G A 3: 99,187,649 V87I probably benign Het
Zdhhc14 T A 17: 5,685,756 C170S probably damaging Het
Zfp113 C T 5: 138,145,034 C318Y possibly damaging Het
Zfp367 A G 13: 64,152,668 S108P probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R8979:Cntln UTSW 4 85130673 missense probably damaging 1.00
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9353:Cntln UTSW 4 84884360 unclassified probably benign
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9478:Cntln UTSW 4 84979393 missense probably benign 0.00
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
R9793:Cntln UTSW 4 85067561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAATGAAAGTAGGTTGCACG -3'
(R):5'- AGTGAGGTCGTCTCTATGCAG -3'

Sequencing Primer
(F):5'- GTTGCACGTATAGAACAATGCAGTC -3'
(R):5'- GAGGTCGTCTCTATGCAGTAACATC -3'
Posted On 2020-07-28