Incidental Mutation 'R8247:Pramel5'
ID 640694
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Name PRAME like 5
Synonyms OTTMUSG00000010540
MMRRC Submission 067674-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R8247 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143997203-144007036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143999395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 231 (M231L)
Ref Sequence ENSEMBL: ENSMUSP00000044222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect probably damaging
Transcript: ENSMUST00000035757
AA Change: M231L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: M231L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105752
AA Change: M231L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: M231L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Meta Mutation Damage Score 0.5688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,155,942 (GRCm39) S3P unknown Het
Abca15 A T 7: 119,936,445 (GRCm39) Y170F possibly damaging Het
Alpl C T 4: 137,473,764 (GRCm39) V313M probably damaging Het
Ankrd44 T C 1: 54,792,102 (GRCm39) H311R probably damaging Het
Atm A T 9: 53,361,870 (GRCm39) L2749Q Het
Bicd2 C T 13: 49,533,462 (GRCm39) R683W probably damaging Het
Brat1 C A 5: 140,698,893 (GRCm39) P342T possibly damaging Het
Camta1 T A 4: 151,159,721 (GRCm39) T482S probably damaging Het
Carhsp1 A G 16: 8,481,535 (GRCm39) V67A probably damaging Het
Carmil1 T A 13: 24,282,998 (GRCm39) N512I probably damaging Het
Ccdc126 C T 6: 49,316,775 (GRCm39) T85M probably damaging Het
Cd274 C T 19: 29,362,795 (GRCm39) Q286* probably null Het
Cep192 T A 18: 67,974,188 (GRCm39) I1097N probably benign Het
Cimip4 A C 15: 78,262,992 (GRCm39) S221A probably benign Het
Clvs1 A T 4: 9,281,885 (GRCm39) N110Y possibly damaging Het
Cntln A G 4: 85,019,017 (GRCm39) T102A probably benign Het
Cp A C 3: 20,020,570 (GRCm39) I188L possibly damaging Het
Crh A G 3: 19,748,291 (GRCm39) L117P probably benign Het
Dcaf1 A T 9: 106,731,427 (GRCm39) I635F possibly damaging Het
Dennd2c A G 3: 103,059,637 (GRCm39) D521G probably damaging Het
E2f2 C T 4: 135,900,126 (GRCm39) T12M possibly damaging Het
Eid2 G A 7: 27,967,972 (GRCm39) R198H probably damaging Het
Exosc4 G T 15: 76,213,279 (GRCm39) C74F probably damaging Het
Fanca A T 8: 124,010,694 (GRCm39) probably benign Het
Ganc A T 2: 120,267,181 (GRCm39) Q499L probably null Het
Gfy T C 7: 44,827,710 (GRCm39) T129A possibly damaging Het
Gli3 G T 13: 15,901,360 (GRCm39) M1582I possibly damaging Het
Gm4744 A G 6: 40,926,402 (GRCm39) S63P Het
Htr2b T C 1: 86,027,817 (GRCm39) T230A probably benign Het
Iqcb1 T A 16: 36,678,836 (GRCm39) N383K probably benign Het
Lpcat1 A T 13: 73,662,071 (GRCm39) I471F probably damaging Het
Lrch3 T G 16: 32,829,713 (GRCm39) L781* probably null Het
Lrif1 T A 3: 106,641,692 (GRCm39) S3T probably damaging Het
Lrp2 T A 2: 69,261,431 (GRCm39) R4503S possibly damaging Het
Lrrc8c T C 5: 105,756,310 (GRCm39) I695T probably damaging Het
Mak G A 13: 41,193,146 (GRCm39) T473M possibly damaging Het
Map2k5 A T 9: 63,279,019 (GRCm39) Y62N probably damaging Het
Mbd3l2 T C 9: 18,356,299 (GRCm39) L208P probably damaging Het
Myo18b T C 5: 112,840,062 (GRCm39) E2577G probably damaging Het
Nfia A T 4: 97,953,644 (GRCm39) T461S probably benign Het
Oaz3 A G 3: 94,343,741 (GRCm39) Y41H probably damaging Het
Or10ab5 T A 7: 108,245,370 (GRCm39) I138F probably damaging Het
Or1p1 C A 11: 74,180,315 (GRCm39) T281K noncoding transcript Het
Or2ad1 A G 13: 21,326,295 (GRCm39) S311P probably benign Het
Or51m1 T C 7: 103,578,783 (GRCm39) V251A possibly damaging Het
Pin1rt1 T C 2: 104,544,892 (GRCm39) E80G probably damaging Het
Pmpcb T C 5: 21,961,852 (GRCm39) Y457H probably damaging Het
Polr2b T C 5: 77,468,062 (GRCm39) S121P possibly damaging Het
Ppm1e C T 11: 87,122,101 (GRCm39) G619R probably benign Het
Prex2 G T 1: 11,270,194 (GRCm39) C1293F probably benign Het
Psg20 A G 7: 18,416,562 (GRCm39) F185L probably benign Het
Psg28 A G 7: 18,156,864 (GRCm39) V457A probably benign Het
Pxmp2 A G 5: 110,422,445 (GRCm39) L188P probably damaging Het
Scd3 A T 19: 44,227,003 (GRCm39) N279I possibly damaging Het
Scg2 T G 1: 79,414,236 (GRCm39) K162N possibly damaging Het
Sipa1l2 T C 8: 126,149,372 (GRCm39) E1629G probably benign Het
Slc27a2 T A 2: 126,395,515 (GRCm39) F147L probably benign Het
Smco1 T C 16: 32,092,557 (GRCm39) V76A probably benign Het
Spic T C 10: 88,511,923 (GRCm39) K111R probably damaging Het
Spidr A G 16: 15,786,390 (GRCm39) probably null Het
Sptbn1 T A 11: 30,063,906 (GRCm39) I1971F possibly damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Tiam1 G A 16: 89,695,037 (GRCm39) T140M probably benign Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ufl1 T C 4: 25,250,606 (GRCm39) E749G probably benign Het
Vmn1r168 G T 7: 23,240,487 (GRCm39) V115F possibly damaging Het
Wars2 G A 3: 99,094,965 (GRCm39) V87I probably benign Het
Zdhhc14 T A 17: 5,736,031 (GRCm39) C170S probably damaging Het
Zfp113 C T 5: 138,143,296 (GRCm39) C318Y possibly damaging Het
Zfp367 A G 13: 64,300,482 (GRCm39) S108P probably benign Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 143,998,191 (GRCm39) missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144,000,549 (GRCm39) missense probably damaging 1.00
IGL01070:Pramel5 APN 4 143,997,842 (GRCm39) missense probably damaging 1.00
IGL01298:Pramel5 APN 4 143,997,732 (GRCm39) utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144,000,429 (GRCm39) missense probably benign 0.01
IGL02150:Pramel5 APN 4 143,999,771 (GRCm39) missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 143,998,121 (GRCm39) missense probably damaging 1.00
IGL02671:Pramel5 APN 4 143,999,682 (GRCm39) missense probably benign 0.25
IGL02868:Pramel5 APN 4 143,997,922 (GRCm39) missense probably benign 0.03
IGL02981:Pramel5 APN 4 143,999,430 (GRCm39) missense probably benign 0.01
R0532:Pramel5 UTSW 4 143,999,310 (GRCm39) missense probably benign 0.03
R0646:Pramel5 UTSW 4 143,998,190 (GRCm39) missense probably damaging 1.00
R1328:Pramel5 UTSW 4 143,998,058 (GRCm39) missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144,000,433 (GRCm39) nonsense probably null
R2027:Pramel5 UTSW 4 143,998,274 (GRCm39) missense probably damaging 1.00
R2240:Pramel5 UTSW 4 143,999,506 (GRCm39) nonsense probably null
R2439:Pramel5 UTSW 4 144,000,310 (GRCm39) missense probably benign 0.01
R3922:Pramel5 UTSW 4 143,999,622 (GRCm39) missense probably damaging 1.00
R4470:Pramel5 UTSW 4 143,997,915 (GRCm39) missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 143,999,325 (GRCm39) missense probably benign 0.04
R4969:Pramel5 UTSW 4 143,998,187 (GRCm39) missense probably damaging 1.00
R5195:Pramel5 UTSW 4 143,998,311 (GRCm39) missense probably benign 0.01
R5198:Pramel5 UTSW 4 144,000,064 (GRCm39) intron probably benign
R5930:Pramel5 UTSW 4 143,999,553 (GRCm39) missense probably benign 0.43
R5988:Pramel5 UTSW 4 143,999,716 (GRCm39) missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 143,999,675 (GRCm39) missense probably benign 0.32
R6988:Pramel5 UTSW 4 144,000,577 (GRCm39) start gained probably benign
R7116:Pramel5 UTSW 4 144,000,451 (GRCm39) missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 143,998,010 (GRCm39) missense possibly damaging 0.93
R8993:Pramel5 UTSW 4 143,999,529 (GRCm39) missense possibly damaging 0.81
R9049:Pramel5 UTSW 4 144,000,486 (GRCm39) missense probably benign 0.02
R9402:Pramel5 UTSW 4 143,998,026 (GRCm39) missense probably benign 0.15
R9632:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
R9710:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
X0028:Pramel5 UTSW 4 143,999,406 (GRCm39) missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144,000,430 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATTTGGTCCAGGCGTTC -3'
(R):5'- AGTACTGCCGACATTCTAAATACC -3'

Sequencing Primer
(F):5'- CAGGCGTTCTTTCAGGAAGTAGAC -3'
(R):5'- ACCTAAACTATTTGCATTGGTGGGC -3'
Posted On 2020-07-28