Incidental Mutation 'R8247:Pramel5'
ID640694
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Namepreferentially expressed antigen in melanoma like 5
SynonymsOTTMUSG00000010540
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8247 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144270633-144280488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144272825 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 231 (M231L)
Ref Sequence ENSEMBL: ENSMUSP00000044222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
Predicted Effect probably damaging
Transcript: ENSMUST00000035757
AA Change: M231L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: M231L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105752
AA Change: M231L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: M231L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,962 S3P unknown Het
Abca15 A T 7: 120,337,222 Y170F possibly damaging Het
Alpl C T 4: 137,746,453 V313M probably damaging Het
Ankrd44 T C 1: 54,752,943 H311R probably damaging Het
Atm A T 9: 53,450,570 L2749Q Het
Bicd2 C T 13: 49,379,986 R683W probably damaging Het
Brat1 C A 5: 140,713,138 P342T possibly damaging Het
Camta1 T A 4: 151,075,264 T482S probably damaging Het
Carhsp1 A G 16: 8,663,671 V67A probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Cd274 C T 19: 29,385,395 Q286* probably null Het
Cep192 T A 18: 67,841,117 I1097N probably benign Het
Clvs1 A T 4: 9,281,885 N110Y possibly damaging Het
Cntln A G 4: 85,100,780 T102A probably benign Het
Cp A C 3: 19,966,406 I188L possibly damaging Het
Crh A G 3: 19,694,127 L117P probably benign Het
Dennd2c A G 3: 103,152,321 D521G probably damaging Het
E2f2 C T 4: 136,172,815 T12M possibly damaging Het
Eid2 G A 7: 28,268,547 R198H probably damaging Het
Exosc4 G T 15: 76,329,079 C74F probably damaging Het
Ganc A T 2: 120,436,700 Q499L probably null Het
Gfy T C 7: 45,178,286 T129A possibly damaging Het
Gli3 G T 13: 15,726,775 M1582I possibly damaging Het
Gm4744 A G 6: 40,949,468 S63P Het
Htr2b T C 1: 86,100,095 T230A probably benign Het
Iqcb1 T A 16: 36,858,474 N383K probably benign Het
Lpcat1 A T 13: 73,513,952 I471F probably damaging Het
Lrch3 T G 16: 33,009,343 L781* probably null Het
Lrif1 T A 3: 106,734,376 S3T probably damaging Het
Lrp2 T A 2: 69,431,087 R4503S possibly damaging Het
Lrrc16a T A 13: 24,099,015 N512I probably damaging Het
Lrrc8c T C 5: 105,608,444 I695T probably damaging Het
Mak G A 13: 41,039,670 T473M possibly damaging Het
Map2k5 A T 9: 63,371,737 Y62N probably damaging Het
Mbd3l2 T C 9: 18,445,003 L208P probably damaging Het
Myo18b T C 5: 112,692,196 E2577G probably damaging Het
Nfia A T 4: 98,065,407 T461S probably benign Het
Oaz3 A G 3: 94,436,434 Y41H probably damaging Het
Olfr1368 A G 13: 21,142,125 S311P probably benign Het
Olfr509 T A 7: 108,646,163 I138F probably damaging Het
Olfr59 C A 11: 74,289,489 T281K noncoding transcript Het
Olfr631 T C 7: 103,929,576 V251A possibly damaging Het
Pin1rt1 T C 2: 104,714,547 E80G probably damaging Het
Pmpcb T C 5: 21,756,854 Y457H probably damaging Het
Polr2b T C 5: 77,320,215 S121P possibly damaging Het
Ppm1e C T 11: 87,231,275 G619R probably benign Het
Prex2 G T 1: 11,199,970 C1293F probably benign Het
Psg20 A G 7: 18,682,637 F185L probably benign Het
Psg28 A G 7: 18,422,939 V457A probably benign Het
Pxmp2 A G 5: 110,274,579 L188P probably damaging Het
Scd3 A T 19: 44,238,564 N279I possibly damaging Het
Scg2 T G 1: 79,436,519 K162N possibly damaging Het
Sipa1l2 T C 8: 125,422,633 E1629G probably benign Het
Slc27a2 T A 2: 126,553,595 F147L probably benign Het
Smco1 T C 16: 32,273,739 V76A probably benign Het
Spic T C 10: 88,676,061 K111R probably damaging Het
Spidr A G 16: 15,968,526 probably null Het
Sptbn1 T A 11: 30,113,906 I1971F possibly damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Tex33 A C 15: 78,378,792 S221A probably benign Het
Tiam1 G A 16: 89,898,149 T140M probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ufl1 T C 4: 25,250,606 E749G probably benign Het
Vmn1r168 G T 7: 23,541,062 V115F possibly damaging Het
Vprbp A T 9: 106,854,228 I635F possibly damaging Het
Wars2 G A 3: 99,187,649 V87I probably benign Het
Zdhhc14 T A 17: 5,685,756 C170S probably damaging Het
Zfp113 C T 5: 138,145,034 C318Y possibly damaging Het
Zfp367 A G 13: 64,152,668 S108P probably benign Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 144271621 missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144273979 missense probably damaging 1.00
IGL01070:Pramel5 APN 4 144271272 missense probably damaging 1.00
IGL01298:Pramel5 APN 4 144271162 utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144273859 missense probably benign 0.01
IGL02150:Pramel5 APN 4 144273201 missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 144271551 missense probably damaging 1.00
IGL02671:Pramel5 APN 4 144273112 missense probably benign 0.25
IGL02868:Pramel5 APN 4 144271352 missense probably benign 0.03
IGL02981:Pramel5 APN 4 144272860 missense probably benign 0.01
R0532:Pramel5 UTSW 4 144272740 missense probably benign 0.03
R0646:Pramel5 UTSW 4 144271620 missense probably damaging 1.00
R1328:Pramel5 UTSW 4 144271488 missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144273863 nonsense probably null
R2027:Pramel5 UTSW 4 144271704 missense probably damaging 1.00
R2240:Pramel5 UTSW 4 144272936 nonsense probably null
R2439:Pramel5 UTSW 4 144273740 missense probably benign 0.01
R3922:Pramel5 UTSW 4 144273052 missense probably damaging 1.00
R4470:Pramel5 UTSW 4 144271345 missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 144272755 missense probably benign 0.04
R4969:Pramel5 UTSW 4 144271617 missense probably damaging 1.00
R5195:Pramel5 UTSW 4 144271741 missense probably benign 0.01
R5198:Pramel5 UTSW 4 144273494 intron probably benign
R5930:Pramel5 UTSW 4 144272983 missense probably benign 0.43
R5988:Pramel5 UTSW 4 144273146 missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 144273105 missense probably benign 0.32
R6988:Pramel5 UTSW 4 144274007 start gained probably benign
R7116:Pramel5 UTSW 4 144273881 missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 144271440 missense possibly damaging 0.93
X0028:Pramel5 UTSW 4 144272836 missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144273860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATTTGGTCCAGGCGTTC -3'
(R):5'- AGTACTGCCGACATTCTAAATACC -3'

Sequencing Primer
(F):5'- CAGGCGTTCTTTCAGGAAGTAGAC -3'
(R):5'- ACCTAAACTATTTGCATTGGTGGGC -3'
Posted On2020-07-28