Mutagenetix > Incidental Mutation

Incidental Mutation 'R8247:Ttc28'

640700

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8247 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111233341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1240 (D1240N)

Ref Sequence

ENSEMBL: ENSMUSP00000136116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

AlphaFold

Q80XJ3

Predicted Effect

probably benign
Transcript: ENSMUST00000040111
AA Change: D1240N

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: D1240N

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156290
AA Change: D1209N

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: D1209N

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Meta Mutation Damage Score

0.1323

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	T	C	6: 52,178,962	S3P	unknown	Het
Abca15	A	T	7: 120,337,222	Y170F	possibly damaging	Het
Alpl	C	T	4: 137,746,453	V313M	probably damaging	Het
Ankrd44	T	C	1: 54,752,943	H311R	probably damaging	Het
Atm	A	T	9: 53,450,570	L2749Q		Het
Bicd2	C	T	13: 49,379,986	R683W	probably damaging	Het
Brat1	C	A	5: 140,713,138	P342T	possibly damaging	Het
Camta1	T	A	4: 151,075,264	T482S	probably damaging	Het
Carhsp1	A	G	16: 8,663,671	V67A	probably damaging	Het
Ccdc126	C	T	6: 49,339,841	T85M	probably damaging	Het
Cd274	C	T	19: 29,385,395	Q286*	probably null	Het
Cep192	T	A	18: 67,841,117	I1097N	probably benign	Het
Clvs1	A	T	4: 9,281,885	N110Y	possibly damaging	Het
Cntln	A	G	4: 85,100,780	T102A	probably benign	Het
Cp	A	C	3: 19,966,406	I188L	possibly damaging	Het
Crh	A	G	3: 19,694,127	L117P	probably benign	Het
Dennd2c	A	G	3: 103,152,321	D521G	probably damaging	Het
E2f2	C	T	4: 136,172,815	T12M	possibly damaging	Het
Eid2	G	A	7: 28,268,547	R198H	probably damaging	Het
Exosc4	G	T	15: 76,329,079	C74F	probably damaging	Het
Fanca	A	T	8: 123,283,955		probably benign	Het
Ganc	A	T	2: 120,436,700	Q499L	probably null	Het
Gfy	T	C	7: 45,178,286	T129A	possibly damaging	Het
Gli3	G	T	13: 15,726,775	M1582I	possibly damaging	Het
Gm4744	A	G	6: 40,949,468	S63P		Het
Htr2b	T	C	1: 86,100,095	T230A	probably benign	Het
Iqcb1	T	A	16: 36,858,474	N383K	probably benign	Het
Lpcat1	A	T	13: 73,513,952	I471F	probably damaging	Het
Lrch3	T	G	16: 33,009,343	L781*	probably null	Het
Lrif1	T	A	3: 106,734,376	S3T	probably damaging	Het
Lrp2	T	A	2: 69,431,087	R4503S	possibly damaging	Het
Lrrc16a	T	A	13: 24,099,015	N512I	probably damaging	Het
Lrrc8c	T	C	5: 105,608,444	I695T	probably damaging	Het
Mak	G	A	13: 41,039,670	T473M	possibly damaging	Het
Map2k5	A	T	9: 63,371,737	Y62N	probably damaging	Het
Mbd3l2	T	C	9: 18,445,003	L208P	probably damaging	Het
Myo18b	T	C	5: 112,692,196	E2577G	probably damaging	Het
Nfia	A	T	4: 98,065,407	T461S	probably benign	Het
Oaz3	A	G	3: 94,436,434	Y41H	probably damaging	Het
Olfr1368	A	G	13: 21,142,125	S311P	probably benign	Het
Olfr509	T	A	7: 108,646,163	I138F	probably damaging	Het
Olfr59	C	A	11: 74,289,489	T281K	noncoding transcript	Het
Olfr631	T	C	7: 103,929,576	V251A	possibly damaging	Het
Pin1rt1	T	C	2: 104,714,547	E80G	probably damaging	Het
Pmpcb	T	C	5: 21,756,854	Y457H	probably damaging	Het
Polr2b	T	C	5: 77,320,215	S121P	possibly damaging	Het
Ppm1e	C	T	11: 87,231,275	G619R	probably benign	Het
Pramel5	T	A	4: 144,272,825	M231L	probably damaging	Het
Prex2	G	T	1: 11,199,970	C1293F	probably benign	Het
Psg20	A	G	7: 18,682,637	F185L	probably benign	Het
Psg28	A	G	7: 18,422,939	V457A	probably benign	Het
Pxmp2	A	G	5: 110,274,579	L188P	probably damaging	Het
Scd3	A	T	19: 44,238,564	N279I	possibly damaging	Het
Scg2	T	G	1: 79,436,519	K162N	possibly damaging	Het
Sipa1l2	T	C	8: 125,422,633	E1629G	probably benign	Het
Slc27a2	T	A	2: 126,553,595	F147L	probably benign	Het
Smco1	T	C	16: 32,273,739	V76A	probably benign	Het
Spic	T	C	10: 88,676,061	K111R	probably damaging	Het
Spidr	A	G	16: 15,968,526		probably null	Het
Sptbn1	T	A	11: 30,113,906	I1971F	possibly damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Tex33	A	C	15: 78,378,792	S221A	probably benign	Het
Tiam1	G	A	16: 89,898,149	T140M	probably benign	Het
Ufl1	T	C	4: 25,250,606	E749G	probably benign	Het
Vmn1r168	G	T	7: 23,541,062	V115F	possibly damaging	Het
Vprbp	A	T	9: 106,854,228	I635F	possibly damaging	Het
Wars2	G	A	3: 99,187,649	V87I	probably benign	Het
Zdhhc14	T	A	17: 5,685,756	C170S	probably damaging	Het
Zfp113	C	T	5: 138,145,034	C318Y	possibly damaging	Het
Zfp367	A	G	13: 64,152,668	S108P	probably benign	Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0582:Ttc28	UTSW	5	111183296	missense	probably damaging	1.00
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1386:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4840:Ttc28	UTSW	5	111286081	missense	probably damaging	1.00
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5851:Ttc28	UTSW	5	111235469	splice site	probably benign
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7350:Ttc28	UTSW	5	111226037	missense	probably damaging	0.97
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
R8346:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8356:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8423:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8424:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8426:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8441:Ttc28	UTSW	5	111177641	nonsense	probably null
R8494:Ttc28	UTSW	5	111235640	missense	probably damaging	0.96
R8508:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8510:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8729:Ttc28	UTSW	5	111235643	critical splice donor site	probably null
R8845:Ttc28	UTSW	5	111224175	missense	probably benign	0.11
R9003:Ttc28	UTSW	5	111277030	missense	probably benign	0.00
R9185:Ttc28	UTSW	5	111223476	missense	probably benign	0.03
R9187:Ttc28	UTSW	5	111102036	missense	probably damaging	1.00
R9245:Ttc28	UTSW	5	111177659	missense	unknown
R9251:Ttc28	UTSW	5	110892832	missense	possibly damaging	0.47
R9372:Ttc28	UTSW	5	111183207	missense	probably benign	0.25
R9466:Ttc28	UTSW	5	111183029	missense	probably damaging	0.99
R9563:Ttc28	UTSW	5	111223226	missense	probably benign	0.22
R9606:Ttc28	UTSW	5	111285274	missense	probably benign	0.00
R9691:Ttc28	UTSW	5	111284013	missense	probably benign	0.01
R9709:Ttc28	UTSW	5	111285771	missense	probably damaging	0.97
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AATTCTGCCAGCGCTGACAC -3'
(R):5'- TTCATCTGACACATGTGGCG -3'

Sequencing Primer
(F):5'- TGACACAGAGGCCGTGG -3'
(R):5'- CACATGTGGCGCCGCTC -3'

Posted On

2020-07-28