Incidental Mutation 'R8247:Sipa1l2'
ID640715
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R8247 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125422633 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1629 (E1629G)
Ref Sequence ENSEMBL: ENSMUSP00000104405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably benign
Transcript: ENSMUST00000108775
AA Change: E1629G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: E1629G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: E1611G

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212987
AA Change: E1629G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,962 S3P unknown Het
Abca15 A T 7: 120,337,222 Y170F possibly damaging Het
Alpl C T 4: 137,746,453 V313M probably damaging Het
Ankrd44 T C 1: 54,752,943 H311R probably damaging Het
Atm A T 9: 53,450,570 L2749Q Het
Bicd2 C T 13: 49,379,986 R683W probably damaging Het
Brat1 C A 5: 140,713,138 P342T possibly damaging Het
Camta1 T A 4: 151,075,264 T482S probably damaging Het
Carhsp1 A G 16: 8,663,671 V67A probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Cd274 C T 19: 29,385,395 Q286* probably null Het
Cep192 T A 18: 67,841,117 I1097N probably benign Het
Clvs1 A T 4: 9,281,885 N110Y possibly damaging Het
Cntln A G 4: 85,100,780 T102A probably benign Het
Cp A C 3: 19,966,406 I188L possibly damaging Het
Crh A G 3: 19,694,127 L117P probably benign Het
Dennd2c A G 3: 103,152,321 D521G probably damaging Het
E2f2 C T 4: 136,172,815 T12M possibly damaging Het
Eid2 G A 7: 28,268,547 R198H probably damaging Het
Exosc4 G T 15: 76,329,079 C74F probably damaging Het
Ganc A T 2: 120,436,700 Q499L probably null Het
Gfy T C 7: 45,178,286 T129A possibly damaging Het
Gli3 G T 13: 15,726,775 M1582I possibly damaging Het
Gm4744 A G 6: 40,949,468 S63P Het
Htr2b T C 1: 86,100,095 T230A probably benign Het
Iqcb1 T A 16: 36,858,474 N383K probably benign Het
Lpcat1 A T 13: 73,513,952 I471F probably damaging Het
Lrch3 T G 16: 33,009,343 L781* probably null Het
Lrif1 T A 3: 106,734,376 S3T probably damaging Het
Lrp2 T A 2: 69,431,087 R4503S possibly damaging Het
Lrrc16a T A 13: 24,099,015 N512I probably damaging Het
Lrrc8c T C 5: 105,608,444 I695T probably damaging Het
Mak G A 13: 41,039,670 T473M possibly damaging Het
Map2k5 A T 9: 63,371,737 Y62N probably damaging Het
Mbd3l2 T C 9: 18,445,003 L208P probably damaging Het
Myo18b T C 5: 112,692,196 E2577G probably damaging Het
Nfia A T 4: 98,065,407 T461S probably benign Het
Oaz3 A G 3: 94,436,434 Y41H probably damaging Het
Olfr1368 A G 13: 21,142,125 S311P probably benign Het
Olfr509 T A 7: 108,646,163 I138F probably damaging Het
Olfr59 C A 11: 74,289,489 T281K noncoding transcript Het
Olfr631 T C 7: 103,929,576 V251A possibly damaging Het
Pin1rt1 T C 2: 104,714,547 E80G probably damaging Het
Pmpcb T C 5: 21,756,854 Y457H probably damaging Het
Polr2b T C 5: 77,320,215 S121P possibly damaging Het
Ppm1e C T 11: 87,231,275 G619R probably benign Het
Pramel5 T A 4: 144,272,825 M231L probably damaging Het
Prex2 G T 1: 11,199,970 C1293F probably benign Het
Psg20 A G 7: 18,682,637 F185L probably benign Het
Psg28 A G 7: 18,422,939 V457A probably benign Het
Pxmp2 A G 5: 110,274,579 L188P probably damaging Het
Scd3 A T 19: 44,238,564 N279I possibly damaging Het
Scg2 T G 1: 79,436,519 K162N possibly damaging Het
Slc27a2 T A 2: 126,553,595 F147L probably benign Het
Smco1 T C 16: 32,273,739 V76A probably benign Het
Spic T C 10: 88,676,061 K111R probably damaging Het
Spidr A G 16: 15,968,526 probably null Het
Sptbn1 T A 11: 30,113,906 I1971F possibly damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Tex33 A C 15: 78,378,792 S221A probably benign Het
Tiam1 G A 16: 89,898,149 T140M probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ufl1 T C 4: 25,250,606 E749G probably benign Het
Vmn1r168 G T 7: 23,541,062 V115F possibly damaging Het
Vprbp A T 9: 106,854,228 I635F possibly damaging Het
Wars2 G A 3: 99,187,649 V87I probably benign Het
Zdhhc14 T A 17: 5,685,756 C170S probably damaging Het
Zfp113 C T 5: 138,145,034 C318Y possibly damaging Het
Zfp367 A G 13: 64,152,668 S108P probably benign Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATGATGAGAGTCAGTGCCTGG -3'
(R):5'- TAAGGAGGGTCAGCAGATTCC -3'

Sequencing Primer
(F):5'- GTCTATGCAGTATGATGGTCACACAG -3'
(R):5'- GGGTCAGCAGATTCCATTCAG -3'
Posted On2020-07-28