Incidental Mutation 'R8247:Map2k5'
ID640718
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8247 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63371737 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 62 (Y62N)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034920
AA Change: Y62N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: Y62N

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,962 S3P unknown Het
Abca15 A T 7: 120,337,222 Y170F possibly damaging Het
Alpl C T 4: 137,746,453 V313M probably damaging Het
Ankrd44 T C 1: 54,752,943 H311R probably damaging Het
Atm A T 9: 53,450,570 L2749Q Het
Bicd2 C T 13: 49,379,986 R683W probably damaging Het
Brat1 C A 5: 140,713,138 P342T possibly damaging Het
Camta1 T A 4: 151,075,264 T482S probably damaging Het
Carhsp1 A G 16: 8,663,671 V67A probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Cd274 C T 19: 29,385,395 Q286* probably null Het
Cep192 T A 18: 67,841,117 I1097N probably benign Het
Clvs1 A T 4: 9,281,885 N110Y possibly damaging Het
Cntln A G 4: 85,100,780 T102A probably benign Het
Cp A C 3: 19,966,406 I188L possibly damaging Het
Crh A G 3: 19,694,127 L117P probably benign Het
Dennd2c A G 3: 103,152,321 D521G probably damaging Het
E2f2 C T 4: 136,172,815 T12M possibly damaging Het
Eid2 G A 7: 28,268,547 R198H probably damaging Het
Exosc4 G T 15: 76,329,079 C74F probably damaging Het
Fanca A T 8: 123,283,955 probably benign Het
Ganc A T 2: 120,436,700 Q499L probably null Het
Gfy T C 7: 45,178,286 T129A possibly damaging Het
Gli3 G T 13: 15,726,775 M1582I possibly damaging Het
Gm4744 A G 6: 40,949,468 S63P Het
Htr2b T C 1: 86,100,095 T230A probably benign Het
Iqcb1 T A 16: 36,858,474 N383K probably benign Het
Lpcat1 A T 13: 73,513,952 I471F probably damaging Het
Lrch3 T G 16: 33,009,343 L781* probably null Het
Lrif1 T A 3: 106,734,376 S3T probably damaging Het
Lrp2 T A 2: 69,431,087 R4503S possibly damaging Het
Lrrc16a T A 13: 24,099,015 N512I probably damaging Het
Lrrc8c T C 5: 105,608,444 I695T probably damaging Het
Mak G A 13: 41,039,670 T473M possibly damaging Het
Mbd3l2 T C 9: 18,445,003 L208P probably damaging Het
Myo18b T C 5: 112,692,196 E2577G probably damaging Het
Nfia A T 4: 98,065,407 T461S probably benign Het
Oaz3 A G 3: 94,436,434 Y41H probably damaging Het
Olfr1368 A G 13: 21,142,125 S311P probably benign Het
Olfr509 T A 7: 108,646,163 I138F probably damaging Het
Olfr59 C A 11: 74,289,489 T281K noncoding transcript Het
Olfr631 T C 7: 103,929,576 V251A possibly damaging Het
Pin1rt1 T C 2: 104,714,547 E80G probably damaging Het
Pmpcb T C 5: 21,756,854 Y457H probably damaging Het
Polr2b T C 5: 77,320,215 S121P possibly damaging Het
Ppm1e C T 11: 87,231,275 G619R probably benign Het
Pramel5 T A 4: 144,272,825 M231L probably damaging Het
Prex2 G T 1: 11,199,970 C1293F probably benign Het
Psg20 A G 7: 18,682,637 F185L probably benign Het
Psg28 A G 7: 18,422,939 V457A probably benign Het
Pxmp2 A G 5: 110,274,579 L188P probably damaging Het
Scd3 A T 19: 44,238,564 N279I possibly damaging Het
Scg2 T G 1: 79,436,519 K162N possibly damaging Het
Sipa1l2 T C 8: 125,422,633 E1629G probably benign Het
Slc27a2 T A 2: 126,553,595 F147L probably benign Het
Smco1 T C 16: 32,273,739 V76A probably benign Het
Spic T C 10: 88,676,061 K111R probably damaging Het
Spidr A G 16: 15,968,526 probably null Het
Sptbn1 T A 11: 30,113,906 I1971F possibly damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Tex33 A C 15: 78,378,792 S221A probably benign Het
Tiam1 G A 16: 89,898,149 T140M probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ufl1 T C 4: 25,250,606 E749G probably benign Het
Vmn1r168 G T 7: 23,541,062 V115F possibly damaging Het
Vprbp A T 9: 106,854,228 I635F possibly damaging Het
Wars2 G A 3: 99,187,649 V87I probably benign Het
Zdhhc14 T A 17: 5,685,756 C170S probably damaging Het
Zfp113 C T 5: 138,145,034 C318Y possibly damaging Het
Zfp367 A G 13: 64,152,668 S108P probably benign Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTAGAGATATGCACACCCAAG -3'
(R):5'- AGTGTGATTGCAAGCTCATGTTTC -3'

Sequencing Primer
(F):5'- TAGAGATATGCACACCCAAGATATG -3'
(R):5'- CTGTGGTTTATGCCAGCATTTCAG -3'
Posted On2020-07-28