Incidental Mutation 'R8247:Gli3'
ID 640724
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 067674-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8247 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15901360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1582 (M1582I)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: M1582I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: M1582I

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,155,942 (GRCm39) S3P unknown Het
Abca15 A T 7: 119,936,445 (GRCm39) Y170F possibly damaging Het
Alpl C T 4: 137,473,764 (GRCm39) V313M probably damaging Het
Ankrd44 T C 1: 54,792,102 (GRCm39) H311R probably damaging Het
Atm A T 9: 53,361,870 (GRCm39) L2749Q Het
Bicd2 C T 13: 49,533,462 (GRCm39) R683W probably damaging Het
Brat1 C A 5: 140,698,893 (GRCm39) P342T possibly damaging Het
Camta1 T A 4: 151,159,721 (GRCm39) T482S probably damaging Het
Carhsp1 A G 16: 8,481,535 (GRCm39) V67A probably damaging Het
Carmil1 T A 13: 24,282,998 (GRCm39) N512I probably damaging Het
Ccdc126 C T 6: 49,316,775 (GRCm39) T85M probably damaging Het
Cd274 C T 19: 29,362,795 (GRCm39) Q286* probably null Het
Cep192 T A 18: 67,974,188 (GRCm39) I1097N probably benign Het
Cimip4 A C 15: 78,262,992 (GRCm39) S221A probably benign Het
Clvs1 A T 4: 9,281,885 (GRCm39) N110Y possibly damaging Het
Cntln A G 4: 85,019,017 (GRCm39) T102A probably benign Het
Cp A C 3: 20,020,570 (GRCm39) I188L possibly damaging Het
Crh A G 3: 19,748,291 (GRCm39) L117P probably benign Het
Dcaf1 A T 9: 106,731,427 (GRCm39) I635F possibly damaging Het
Dennd2c A G 3: 103,059,637 (GRCm39) D521G probably damaging Het
E2f2 C T 4: 135,900,126 (GRCm39) T12M possibly damaging Het
Eid2 G A 7: 27,967,972 (GRCm39) R198H probably damaging Het
Exosc4 G T 15: 76,213,279 (GRCm39) C74F probably damaging Het
Fanca A T 8: 124,010,694 (GRCm39) probably benign Het
Ganc A T 2: 120,267,181 (GRCm39) Q499L probably null Het
Gfy T C 7: 44,827,710 (GRCm39) T129A possibly damaging Het
Gm4744 A G 6: 40,926,402 (GRCm39) S63P Het
Htr2b T C 1: 86,027,817 (GRCm39) T230A probably benign Het
Iqcb1 T A 16: 36,678,836 (GRCm39) N383K probably benign Het
Lpcat1 A T 13: 73,662,071 (GRCm39) I471F probably damaging Het
Lrch3 T G 16: 32,829,713 (GRCm39) L781* probably null Het
Lrif1 T A 3: 106,641,692 (GRCm39) S3T probably damaging Het
Lrp2 T A 2: 69,261,431 (GRCm39) R4503S possibly damaging Het
Lrrc8c T C 5: 105,756,310 (GRCm39) I695T probably damaging Het
Mak G A 13: 41,193,146 (GRCm39) T473M possibly damaging Het
Map2k5 A T 9: 63,279,019 (GRCm39) Y62N probably damaging Het
Mbd3l2 T C 9: 18,356,299 (GRCm39) L208P probably damaging Het
Myo18b T C 5: 112,840,062 (GRCm39) E2577G probably damaging Het
Nfia A T 4: 97,953,644 (GRCm39) T461S probably benign Het
Oaz3 A G 3: 94,343,741 (GRCm39) Y41H probably damaging Het
Or10ab5 T A 7: 108,245,370 (GRCm39) I138F probably damaging Het
Or1p1 C A 11: 74,180,315 (GRCm39) T281K noncoding transcript Het
Or2ad1 A G 13: 21,326,295 (GRCm39) S311P probably benign Het
Or51m1 T C 7: 103,578,783 (GRCm39) V251A possibly damaging Het
Pin1rt1 T C 2: 104,544,892 (GRCm39) E80G probably damaging Het
Pmpcb T C 5: 21,961,852 (GRCm39) Y457H probably damaging Het
Polr2b T C 5: 77,468,062 (GRCm39) S121P possibly damaging Het
Ppm1e C T 11: 87,122,101 (GRCm39) G619R probably benign Het
Pramel5 T A 4: 143,999,395 (GRCm39) M231L probably damaging Het
Prex2 G T 1: 11,270,194 (GRCm39) C1293F probably benign Het
Psg20 A G 7: 18,416,562 (GRCm39) F185L probably benign Het
Psg28 A G 7: 18,156,864 (GRCm39) V457A probably benign Het
Pxmp2 A G 5: 110,422,445 (GRCm39) L188P probably damaging Het
Scd3 A T 19: 44,227,003 (GRCm39) N279I possibly damaging Het
Scg2 T G 1: 79,414,236 (GRCm39) K162N possibly damaging Het
Sipa1l2 T C 8: 126,149,372 (GRCm39) E1629G probably benign Het
Slc27a2 T A 2: 126,395,515 (GRCm39) F147L probably benign Het
Smco1 T C 16: 32,092,557 (GRCm39) V76A probably benign Het
Spic T C 10: 88,511,923 (GRCm39) K111R probably damaging Het
Spidr A G 16: 15,786,390 (GRCm39) probably null Het
Sptbn1 T A 11: 30,063,906 (GRCm39) I1971F possibly damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Tiam1 G A 16: 89,695,037 (GRCm39) T140M probably benign Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ufl1 T C 4: 25,250,606 (GRCm39) E749G probably benign Het
Vmn1r168 G T 7: 23,240,487 (GRCm39) V115F possibly damaging Het
Wars2 G A 3: 99,094,965 (GRCm39) V87I probably benign Het
Zdhhc14 T A 17: 5,736,031 (GRCm39) C170S probably damaging Het
Zfp113 C T 5: 138,143,296 (GRCm39) C318Y possibly damaging Het
Zfp367 A G 13: 64,300,482 (GRCm39) S108P probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGTCAGGGGCCTTGAGC -3'
(R):5'- GGGTGATTTGAATGTCACAATACTG -3'

Sequencing Primer
(F):5'- GCCTTGAGCCCAAGTATTATTCAG -3'
(R):5'- AGTTCCTCCCCTAGAATACCTTAGGG -3'
Posted On 2020-07-28