Incidental Mutation 'R8247:Gli3'
ID640724
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8247 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 15726775 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1582 (M1582I)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: M1582I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: M1582I

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,962 S3P unknown Het
Abca15 A T 7: 120,337,222 Y170F possibly damaging Het
Alpl C T 4: 137,746,453 V313M probably damaging Het
Ankrd44 T C 1: 54,752,943 H311R probably damaging Het
Atm A T 9: 53,450,570 L2749Q Het
Bicd2 C T 13: 49,379,986 R683W probably damaging Het
Brat1 C A 5: 140,713,138 P342T possibly damaging Het
Camta1 T A 4: 151,075,264 T482S probably damaging Het
Carhsp1 A G 16: 8,663,671 V67A probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Cd274 C T 19: 29,385,395 Q286* probably null Het
Cep192 T A 18: 67,841,117 I1097N probably benign Het
Clvs1 A T 4: 9,281,885 N110Y possibly damaging Het
Cntln A G 4: 85,100,780 T102A probably benign Het
Cp A C 3: 19,966,406 I188L possibly damaging Het
Crh A G 3: 19,694,127 L117P probably benign Het
Dennd2c A G 3: 103,152,321 D521G probably damaging Het
E2f2 C T 4: 136,172,815 T12M possibly damaging Het
Eid2 G A 7: 28,268,547 R198H probably damaging Het
Exosc4 G T 15: 76,329,079 C74F probably damaging Het
Fanca A T 8: 123,283,955 probably benign Het
Ganc A T 2: 120,436,700 Q499L probably null Het
Gfy T C 7: 45,178,286 T129A possibly damaging Het
Gm4744 A G 6: 40,949,468 S63P Het
Htr2b T C 1: 86,100,095 T230A probably benign Het
Iqcb1 T A 16: 36,858,474 N383K probably benign Het
Lpcat1 A T 13: 73,513,952 I471F probably damaging Het
Lrch3 T G 16: 33,009,343 L781* probably null Het
Lrif1 T A 3: 106,734,376 S3T probably damaging Het
Lrp2 T A 2: 69,431,087 R4503S possibly damaging Het
Lrrc16a T A 13: 24,099,015 N512I probably damaging Het
Lrrc8c T C 5: 105,608,444 I695T probably damaging Het
Mak G A 13: 41,039,670 T473M possibly damaging Het
Map2k5 A T 9: 63,371,737 Y62N probably damaging Het
Mbd3l2 T C 9: 18,445,003 L208P probably damaging Het
Myo18b T C 5: 112,692,196 E2577G probably damaging Het
Nfia A T 4: 98,065,407 T461S probably benign Het
Oaz3 A G 3: 94,436,434 Y41H probably damaging Het
Olfr1368 A G 13: 21,142,125 S311P probably benign Het
Olfr509 T A 7: 108,646,163 I138F probably damaging Het
Olfr59 C A 11: 74,289,489 T281K noncoding transcript Het
Olfr631 T C 7: 103,929,576 V251A possibly damaging Het
Pin1rt1 T C 2: 104,714,547 E80G probably damaging Het
Pmpcb T C 5: 21,756,854 Y457H probably damaging Het
Polr2b T C 5: 77,320,215 S121P possibly damaging Het
Ppm1e C T 11: 87,231,275 G619R probably benign Het
Pramel5 T A 4: 144,272,825 M231L probably damaging Het
Prex2 G T 1: 11,199,970 C1293F probably benign Het
Psg20 A G 7: 18,682,637 F185L probably benign Het
Psg28 A G 7: 18,422,939 V457A probably benign Het
Pxmp2 A G 5: 110,274,579 L188P probably damaging Het
Scd3 A T 19: 44,238,564 N279I possibly damaging Het
Scg2 T G 1: 79,436,519 K162N possibly damaging Het
Sipa1l2 T C 8: 125,422,633 E1629G probably benign Het
Slc27a2 T A 2: 126,553,595 F147L probably benign Het
Smco1 T C 16: 32,273,739 V76A probably benign Het
Spic T C 10: 88,676,061 K111R probably damaging Het
Spidr A G 16: 15,968,526 probably null Het
Sptbn1 T A 11: 30,113,906 I1971F possibly damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Tex33 A C 15: 78,378,792 S221A probably benign Het
Tiam1 G A 16: 89,898,149 T140M probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ufl1 T C 4: 25,250,606 E749G probably benign Het
Vmn1r168 G T 7: 23,541,062 V115F possibly damaging Het
Vprbp A T 9: 106,854,228 I635F possibly damaging Het
Wars2 G A 3: 99,187,649 V87I probably benign Het
Zdhhc14 T A 17: 5,685,756 C170S probably damaging Het
Zfp113 C T 5: 138,145,034 C318Y possibly damaging Het
Zfp367 A G 13: 64,152,668 S108P probably benign Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5494:Gli3 UTSW 13 15725982 missense probably benign 0.28
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
R7228:Gli3 UTSW 13 15724502 missense probably benign 0.00
R7327:Gli3 UTSW 13 15725559 missense probably benign 0.02
R7451:Gli3 UTSW 13 15726291 missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15726256 missense probably benign 0.00
R8167:Gli3 UTSW 13 15725643 missense probably benign 0.00
R8170:Gli3 UTSW 13 15720208 missense probably benign
R8199:Gli3 UTSW 13 15725991 missense probably benign 0.08
R8332:Gli3 UTSW 13 15713548 missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15723525 missense probably damaging 1.00
R8559:Gli3 UTSW 13 15660132 missense probably damaging 1.00
R8676:Gli3 UTSW 13 15715034 missense probably damaging 1.00
R8905:Gli3 UTSW 13 15726531 missense probably benign 0.01
RF010:Gli3 UTSW 13 15726369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGTCAGGGGCCTTGAGC -3'
(R):5'- GGGTGATTTGAATGTCACAATACTG -3'

Sequencing Primer
(F):5'- GCCTTGAGCCCAAGTATTATTCAG -3'
(R):5'- AGTTCCTCCCCTAGAATACCTTAGGG -3'
Posted On2020-07-28