Mutagenetix > Incidental Mutation

Incidental Mutation 'R0096:Myo1d'

64073

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

038382-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0096 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80484332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 972 (L972P)

Ref Sequence

ENSEMBL: ENSMUSP00000037819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000053413]

AlphaFold

Q5SYD0

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: L972P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: L972P

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000053413

SMART Domains

Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	69	294	1.6e-100	PFAM

Meta Mutation Damage Score

0.9132

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.5%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	C	6: 48,931,188	Q374P	probably damaging	Het
4933405L10Rik	A	T	8: 105,708,931		probably null	Het
Adamts3	G	A	5: 89,701,717	Q615*	probably null	Het
Adamtsl3	T	A	7: 82,465,699		probably benign	Het
Anks1b	T	C	10: 90,074,062	S48P	possibly damaging	Het
Arfip2	T	A	7: 105,638,230	K94N	probably damaging	Het
Arhgap42	G	T	9: 9,009,313	N524K	probably damaging	Het
Arhgef28	T	G	13: 97,931,254	T1388P	probably damaging	Het
Arid4b	T	C	13: 14,129,194	V68A	probably benign	Het
BC005537	T	C	13: 24,805,940	F129L	probably damaging	Het
Capn3	A	T	2: 120,502,529	H592L	possibly damaging	Het
Ccdc105	T	A	10: 78,748,705	I328L	probably benign	Het
Dglucy	A	T	12: 100,838,651	I134F	possibly damaging	Het
Dhh	T	A	15: 98,893,988	M380L	probably benign	Het
Dnaic2	A	C	11: 114,754,332	D531A	probably benign	Het
Dthd1	A	T	5: 62,843,040	R568S	possibly damaging	Het
Efr3a	A	G	15: 65,855,441	N613S	probably damaging	Het
Epb41l5	T	A	1: 119,623,911		probably benign	Het
Ermp1	A	G	19: 29,631,388	Y164H	possibly damaging	Het
Fam120c	CCAGCAGCAGCAGCAGCA	CCAGCAGCAGCAGCA	X: 151,344,345		probably benign	Het
Fbrs	C	T	7: 127,489,487	A145V	probably damaging	Het
Gm4736	T	C	6: 132,115,606		noncoding transcript	Het
Gm9873	A	T	2: 169,021,109		noncoding transcript	Het
Grik1	T	C	16: 88,034,226	M219V	possibly damaging	Het
Gtsf1l	C	T	2: 163,087,536	C9Y	probably damaging	Het
Itih5	G	A	2: 10,251,378	R885Q	probably benign	Het
Kdm4c	A	G	4: 74,357,343	E752G	probably damaging	Het
Ksr1	A	G	11: 79,038,247		probably benign	Het
Lama1	T	A	17: 67,805,413	F2283I	probably benign	Het
Luc7l3	A	G	11: 94,301,494		probably benign	Het
Lypd8	A	T	11: 58,386,757	M122L	probably benign	Het
Map1a	A	G	2: 121,301,505	E696G	probably damaging	Het
Mrps34	A	G	17: 24,895,669	D110G	probably damaging	Het
Myh11	T	A	16: 14,204,367	K1710M	possibly damaging	Het
Nos1ap	T	C	1: 170,329,247	D214G	probably damaging	Het
Olfr1224-ps1	A	T	2: 89,156,296	M293K	probably benign	Het
Olfr910	A	T	9: 38,539,536	I214F	probably damaging	Het
Pate4	T	G	9: 35,611,834	T5P	probably damaging	Het
Pygl	A	T	12: 70,191,166		probably benign	Het
Samd4	A	T	14: 47,064,297	M252L	possibly damaging	Het
Serpinb1c	T	A	13: 32,886,283		probably benign	Het
Sis	A	T	3: 72,928,267	W921R	probably damaging	Het
Skint5	A	T	4: 113,597,768		probably benign	Het
Slc27a6	T	C	18: 58,598,757		probably benign	Het
Sycp2	G	T	2: 178,403,735	Q31K	probably damaging	Het
Taar7f	A	G	10: 24,050,254	M249V	probably benign	Het
Tarm1	T	C	7: 3,497,551	T79A	probably benign	Het
Trf	A	G	9: 103,222,159	F300L	probably damaging	Het
Vmn1r69	T	A	7: 10,580,058	I170F	probably damaging	Het
Vmn2r105	A	G	17: 20,227,479	F361S	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,319	Y636C	probably damaging	Het
Wdr59	T	C	8: 111,504,373	N68D	probably damaging	Het
Zfp345	T	A	2: 150,472,300	H439L	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATTAGAGGGCAGACAGCGATTAGC -3'
(R):5'- CGGATTGAACCCTGAAACTGCCAC -3'

Sequencing Primer
(F):5'- CCTGGGATGCTGATCGAG -3'
(R):5'- TGCCACCCTACAGGAGC -3'

Posted On

2013-08-06