Mutagenetix > Incidental Mutation

Incidental Mutation 'R8246:Dnm3'

640744

Institutional Source

Beutler Lab

Gene Symbol

Dnm3

Ensembl Gene

ENSMUSG00000040265

Gene Name

dynamin 3

Synonyms

B230343F03Rik, 9630020E24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8246 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161982453-162478034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 162307917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 429 (D429A)

Ref Sequence

ENSEMBL: ENSMUSP00000064538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000070330
AA Change: D429A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265
AA Change: D429A

Domain	Start	End	E-Value	Type
DYNc	6	245	1.48e-182	SMART
PH	516	623	1.58e-11	SMART
GED	644	735	6.82e-33	SMART
low complexity region	738	751	N/A	INTRINSIC
low complexity region	756	771	N/A	INTRINSIC
low complexity region	799	812	N/A	INTRINSIC
low complexity region	824	852	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000086074
AA Change: D429A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265
AA Change: D429A

Domain	Start	End	E-Value	Type
DYNc	6	245	1.48e-182	SMART
PH	516	623	1.58e-11	SMART
GED	648	739	6.82e-33	SMART
low complexity region	742	755	N/A	INTRINSIC
low complexity region	760	775	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	828	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.2787

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	C	5: 9,446,966	V810A	probably benign	Het
Alpk3	C	A	7: 81,092,776	D780E	probably benign	Het
Anln	A	C	9: 22,350,955	S947A	probably benign	Het
Borcs6	C	T	11: 69,060,551	P252S	probably benign	Het
Ccdc109b	C	A	3: 129,915,165	V328L	probably benign	Het
Ccdc42	C	A	11: 68,587,296	Q28K	probably benign	Het
Cp	A	G	3: 19,975,022	I554M	probably damaging	Het
Dok5	A	G	2: 170,800,893	K37R	probably benign	Het
Dtwd2	A	T	18: 49,698,425	Y268N	probably benign	Het
Eif3a	T	C	19: 60,779,368	E244G	probably damaging	Het
Fam149a	T	C	8: 45,381,618	E48G	probably benign	Het
Fam160a2	T	C	7: 105,389,660	E124G	probably damaging	Het
Fam186a	T	A	15: 99,940,547	E2605D	unknown	Het
Fyn	T	A	10: 39,529,529	W264R	probably damaging	Het
Gm10024	T	A	10: 77,711,535	S27T	unknown	Het
Gm156	A	G	6: 129,775,376		probably benign	Het
Gpr157	C	T	4: 150,102,296	L294F	possibly damaging	Het
Kif6	C	T	17: 49,758,514	Q506*	probably null	Het
Loxhd1	A	G	18: 77,363,546	K707R	possibly damaging	Het
Mdn1	C	T	4: 32,657,284	P12S	probably benign	Het
Mrgprb3	T	G	7: 48,643,520	L94F	probably benign	Het
Mycbp2	G	T	14: 103,155,204	P3307Q	probably damaging	Het
Nol8	T	G	13: 49,655,248		probably benign	Het
Olfr1308	T	C	2: 111,960,138	I312V	probably benign	Het
Olfr744	A	G	14: 50,618,384	Y54C	probably benign	Het
Pax5	T	C	4: 44,570,027	H286R	probably benign	Het
Rmdn2	T	A	17: 79,672,537	C381*	probably null	Het
Rpusd4	A	G	9: 35,272,580	I202V	probably benign	Het
Shank3	A	T	15: 89,533,346	R49W	possibly damaging	Het
Smurf2	T	C	11: 106,831,044	T542A	probably benign	Het
Sorcs2	G	A	5: 36,062,588	R371C	probably damaging	Het
Sqstm1	T	C	11: 50,210,561	H66R	probably damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Svep1	A	T	4: 58,091,889	V1582D	probably damaging	Het
Tecrl	T	C	5: 83,279,309	M331V	probably damaging	Het
Tinf2	T	C	14: 55,679,585	S368G	probably damaging	Het
Tmem184c	A	T	8: 77,610,185	I14N	probably damaging	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Ulk4	T	C	9: 121,156,875	*911W	probably null	Het
Unc13b	T	C	4: 43,175,954	F2261L	unknown	Het
Vps16	G	C	2: 130,438,873	G241R	probably damaging	Het
Ythdc1	C	T	5: 86,817,322	T292I	possibly damaging	Het

Other mutations in Dnm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Dnm3	APN	1	162011926	missense	probably damaging	1.00
IGL02444:Dnm3	APN	1	162010875	missense	possibly damaging	0.46
IGL02481:Dnm3	APN	1	162010902	missense	probably damaging	0.99
IGL02623:Dnm3	APN	1	162355432	missense	probably damaging	0.99
IGL03132:Dnm3	APN	1	162011105	critical splice acceptor site	probably null
IGL03330:Dnm3	APN	1	162320991	missense	probably benign	0.00
fever	UTSW	1	162321127	splice site	probably null
nobel	UTSW	1	162477705	missense	probably damaging	1.00
splotare	UTSW	1	162320987	missense	probably damaging	0.98
LCD18:Dnm3	UTSW	1	162406561	intron	probably benign
R0066:Dnm3	UTSW	1	162407361	missense	probably damaging	0.98
R0066:Dnm3	UTSW	1	162407361	missense	probably damaging	0.98
R0240:Dnm3	UTSW	1	162353625	missense	probably benign	0.00
R0240:Dnm3	UTSW	1	162353625	missense	probably benign	0.00
R0968:Dnm3	UTSW	1	162019819	splice site	probably benign
R1161:Dnm3	UTSW	1	162353574	missense	probably benign	0.06
R1680:Dnm3	UTSW	1	162010976	missense	probably benign	0.12
R1747:Dnm3	UTSW	1	162313584	missense	probably damaging	1.00
R1881:Dnm3	UTSW	1	162477948	start gained	probably benign
R1997:Dnm3	UTSW	1	162353712	missense	possibly damaging	0.60
R2157:Dnm3	UTSW	1	162307893	missense	possibly damaging	0.95
R2270:Dnm3	UTSW	1	162477789	missense	probably damaging	1.00
R2897:Dnm3	UTSW	1	162286074	splice site	probably benign
R3018:Dnm3	UTSW	1	162321759	nonsense	probably null
R3851:Dnm3	UTSW	1	162321127	splice site	probably null
R3861:Dnm3	UTSW	1	162311405	missense	possibly damaging	0.79
R3930:Dnm3	UTSW	1	162084130	missense	probably damaging	1.00
R4432:Dnm3	UTSW	1	161991997	intron	probably benign
R5318:Dnm3	UTSW	1	162011807	nonsense	probably null
R5361:Dnm3	UTSW	1	162010902	missense	probably damaging	0.99
R5606:Dnm3	UTSW	1	162286018	missense	probably damaging	0.99
R5783:Dnm3	UTSW	1	162355471	missense	possibly damaging	0.70
R6019:Dnm3	UTSW	1	162134501	missense	probably damaging	0.99
R6072:Dnm3	UTSW	1	162011068	small deletion	probably benign
R6086:Dnm3	UTSW	1	162321033	missense	probably damaging	0.99
R6110:Dnm3	UTSW	1	162011068	small deletion	probably benign
R6158:Dnm3	UTSW	1	162320987	missense	probably damaging	0.98
R6473:Dnm3	UTSW	1	162477705	missense	probably damaging	1.00
R6499:Dnm3	UTSW	1	162313595	missense	probably damaging	1.00
R6702:Dnm3	UTSW	1	162318687	missense	probably benign	0.04
R6703:Dnm3	UTSW	1	162318687	missense	probably benign	0.04
R6739:Dnm3	UTSW	1	162477783	missense	probably damaging	0.99
R6811:Dnm3	UTSW	1	162321083	missense	probably damaging	0.96
R6915:Dnm3	UTSW	1	162318397	splice site	probably null
R6946:Dnm3	UTSW	1	162313655	missense	possibly damaging	0.91
R7062:Dnm3	UTSW	1	162134491	nonsense	probably null
R7067:Dnm3	UTSW	1	162320971	missense	probably damaging	1.00
R7071:Dnm3	UTSW	1	162019843	missense	probably damaging	0.99
R7468:Dnm3	UTSW	1	162321629	splice site	probably null
R7521:Dnm3	UTSW	1	162134544	missense	probably damaging	1.00
R7583:Dnm3	UTSW	1	162477774	missense	possibly damaging	0.93
R7667:Dnm3	UTSW	1	162011830	missense	probably damaging	1.00
R7711:Dnm3	UTSW	1	161992053	missense	possibly damaging	0.83
R7837:Dnm3	UTSW	1	161992050	missense	possibly damaging	0.94
R7838:Dnm3	UTSW	1	161992050	missense	possibly damaging	0.94
R7900:Dnm3	UTSW	1	162355371	missense	probably benign	0.00
R7939:Dnm3	UTSW	1	162295596	missense	possibly damaging	0.91
R8059:Dnm3	UTSW	1	162084139	missense	probably damaging	1.00
R8123:Dnm3	UTSW	1	162011103	missense	probably benign	0.01
R8249:Dnm3	UTSW	1	162477743	nonsense	probably null
R8511:Dnm3	UTSW	1	162286042	missense	possibly damaging	0.69
R8900:Dnm3	UTSW	1	162307876	missense	probably benign	0.17
R8976:Dnm3	UTSW	1	162307936	missense	probably damaging	1.00
R9455:Dnm3	UTSW	1	162320955	missense	possibly damaging	0.88
R9604:Dnm3	UTSW	1	162011015	missense	possibly damaging	0.55
R9617:Dnm3	UTSW	1	162321785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCACTATAATCGGCCAGTG -3'
(R):5'- ATGCTCAACTTAAGTCCCATGC -3'

Sequencing Primer
(F):5'- TCTCCTTGCACAGACGTAAACTG -3'
(R):5'- CTTAAGTCCCATGCCAGTTTAAAC -3'

Posted On

2020-07-28