Incidental Mutation 'R8246:Olfr1308'
ID 640745
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor 1308
Synonyms MOR245-22, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111959285-111964944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111960138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 312 (I312V)
Ref Sequence ENSEMBL: ENSMUSP00000097200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably benign
Transcript: ENSMUST00000099605
AA Change: I312V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: I312V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207560
AA Change: I312V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gm156 A G 6: 129,775,376 probably benign Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Nol8 T G 13: 49,655,248 probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Pax5 T C 4: 44,570,027 H286R probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Ulk4 T C 9: 121,156,875 *911W probably null Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R9389:Olfr1308 UTSW 2 111960527 missense probably damaging 1.00
R9515:Olfr1308 UTSW 2 111960239 missense possibly damaging 0.54
R9631:Olfr1308 UTSW 2 111961032 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTCTAAGAGCTTCCTTCAGAGAG -3'
(R):5'- TGATGTTCATCTATACATGGCCTTC -3'

Sequencing Primer
(F):5'- GAGCTTCCTTCAGAGAGATATTTGTC -3'
(R):5'- ATGGCCTTCTTCTTTCACACATTTGG -3'
Posted On 2020-07-28