Incidental Mutation 'R8246:Vps16'
ID 640746
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 130280793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 241 (G241R)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: G241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: G241R

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R1789:Vps16 UTSW 2 130,285,520 (GRCm39) missense probably benign 0.42
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5177:Vps16 UTSW 2 130,285,288 (GRCm39) nonsense probably null
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130,285,304 (GRCm39) missense probably damaging 1.00
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7641:Vps16 UTSW 2 130,282,448 (GRCm39) missense probably benign 0.28
R7720:Vps16 UTSW 2 130,283,623 (GRCm39) nonsense probably null
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCTGGATCATGCTACCTG -3'
(R):5'- AGCTTCTCCTGAAACAGCAC -3'

Sequencing Primer
(F):5'- CTCTGCAGTGGTGAGAACCTAAG -3'
(R):5'- AGCACAGCATGTCATGGC -3'
Posted On 2020-07-28