Incidental Mutation 'R8246:Unc13b'
ID 640751
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B
Synonyms Munc13-2, Unc13h2
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43175954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 2261 (F2261L)
Ref Sequence ENSEMBL: ENSMUSP00000147100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
AlphaFold Q9Z1N9
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: F2261L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43,240,285 (GRCm39) missense probably damaging 1.00
IGL00832:Unc13b APN 4 43,258,921 (GRCm39) missense probably damaging 1.00
IGL01111:Unc13b APN 4 43,096,927 (GRCm39) missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43,258,492 (GRCm39) missense probably damaging 1.00
IGL01137:Unc13b APN 4 43,091,291 (GRCm39) missense probably damaging 1.00
IGL01637:Unc13b APN 4 43,241,066 (GRCm39) missense probably damaging 1.00
IGL01789:Unc13b APN 4 43,239,462 (GRCm39) missense probably damaging 1.00
IGL01792:Unc13b APN 4 43,250,218 (GRCm39) missense probably damaging 0.99
IGL01877:Unc13b APN 4 43,249,583 (GRCm39) critical splice donor site probably null
IGL01924:Unc13b APN 4 43,239,385 (GRCm39) nonsense probably null
IGL02087:Unc13b APN 4 43,091,270 (GRCm39) missense probably null 1.00
IGL02197:Unc13b APN 4 43,165,828 (GRCm39) missense probably damaging 0.99
IGL02504:Unc13b APN 4 43,263,031 (GRCm39) missense probably damaging 1.00
IGL02659:Unc13b APN 4 43,235,332 (GRCm39) missense probably damaging 1.00
IGL03031:Unc13b APN 4 43,235,368 (GRCm39) missense probably damaging 1.00
IGL03036:Unc13b APN 4 43,235,249 (GRCm39) missense probably damaging 1.00
IGL03209:Unc13b APN 4 43,239,351 (GRCm39) missense probably damaging 0.99
IGL03352:Unc13b APN 4 43,237,110 (GRCm39) missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
BB016:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
G1Funyon:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
P0028:Unc13b UTSW 4 43,256,225 (GRCm39) missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43,091,298 (GRCm39) missense probably benign 0.03
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43,236,983 (GRCm39) missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43,263,559 (GRCm39) missense probably damaging 0.99
R0631:Unc13b UTSW 4 43,182,849 (GRCm39) missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43,241,164 (GRCm39) splice site probably benign
R1275:Unc13b UTSW 4 43,235,366 (GRCm39) missense probably damaging 1.00
R1293:Unc13b UTSW 4 43,235,190 (GRCm39) missense probably damaging 1.00
R1434:Unc13b UTSW 4 43,239,385 (GRCm39) nonsense probably null
R1552:Unc13b UTSW 4 43,237,144 (GRCm39) missense probably damaging 0.99
R1591:Unc13b UTSW 4 43,244,747 (GRCm39) missense probably damaging 1.00
R1628:Unc13b UTSW 4 43,263,371 (GRCm39) missense probably damaging 1.00
R1740:Unc13b UTSW 4 43,240,285 (GRCm39) missense probably damaging 1.00
R1839:Unc13b UTSW 4 43,258,308 (GRCm39) splice site probably benign
R2045:Unc13b UTSW 4 43,091,266 (GRCm39) missense probably damaging 1.00
R2191:Unc13b UTSW 4 43,245,566 (GRCm39) nonsense probably null
R2259:Unc13b UTSW 4 43,182,780 (GRCm39) missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43,239,854 (GRCm39) missense probably damaging 0.98
R2317:Unc13b UTSW 4 43,245,514 (GRCm39) missense probably damaging 1.00
R2402:Unc13b UTSW 4 43,095,843 (GRCm39) missense probably benign
R2847:Unc13b UTSW 4 43,180,404 (GRCm39) missense probably benign 0.04
R3414:Unc13b UTSW 4 43,234,658 (GRCm39) splice site probably benign
R3436:Unc13b UTSW 4 43,097,028 (GRCm39) splice site probably benign
R3955:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R3957:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R4015:Unc13b UTSW 4 43,237,801 (GRCm39) missense probably damaging 1.00
R4650:Unc13b UTSW 4 43,261,035 (GRCm39) missense probably damaging 0.97
R4836:Unc13b UTSW 4 43,237,137 (GRCm39) missense probably damaging 1.00
R5041:Unc13b UTSW 4 43,237,836 (GRCm39) missense probably benign 0.41
R5413:Unc13b UTSW 4 43,257,936 (GRCm39) critical splice donor site probably null
R5994:Unc13b UTSW 4 43,172,596 (GRCm39) intron probably benign
R6015:Unc13b UTSW 4 43,177,995 (GRCm39) nonsense probably null
R6090:Unc13b UTSW 4 43,239,306 (GRCm39) missense probably damaging 1.00
R6242:Unc13b UTSW 4 43,165,800 (GRCm39) missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43,216,246 (GRCm39) missense probably benign 0.18
R6427:Unc13b UTSW 4 43,176,966 (GRCm39) unclassified probably benign
R6660:Unc13b UTSW 4 43,177,412 (GRCm39) unclassified probably benign
R6670:Unc13b UTSW 4 43,255,562 (GRCm39) missense probably damaging 0.99
R6753:Unc13b UTSW 4 43,239,331 (GRCm39) missense probably damaging 1.00
R6858:Unc13b UTSW 4 43,165,828 (GRCm39) missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43,170,156 (GRCm39) intron probably benign
R6969:Unc13b UTSW 4 43,263,538 (GRCm39) missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43,173,203 (GRCm39) intron probably benign
R6994:Unc13b UTSW 4 43,171,403 (GRCm39) intron probably benign
R7080:Unc13b UTSW 4 43,171,926 (GRCm39) missense unknown
R7117:Unc13b UTSW 4 43,216,544 (GRCm39) missense probably benign 0.33
R7132:Unc13b UTSW 4 43,215,757 (GRCm39) missense probably benign 0.17
R7181:Unc13b UTSW 4 43,258,893 (GRCm39) missense probably damaging 0.99
R7192:Unc13b UTSW 4 43,258,519 (GRCm39) missense probably damaging 1.00
R7246:Unc13b UTSW 4 43,172,910 (GRCm39) missense unknown
R7342:Unc13b UTSW 4 43,258,703 (GRCm39) missense probably damaging 0.99
R7345:Unc13b UTSW 4 43,173,966 (GRCm39) missense unknown
R7355:Unc13b UTSW 4 43,237,754 (GRCm39) missense probably damaging 1.00
R7391:Unc13b UTSW 4 43,216,459 (GRCm39) missense probably benign 0.03
R7419:Unc13b UTSW 4 43,174,023 (GRCm39) missense unknown
R7424:Unc13b UTSW 4 43,172,235 (GRCm39) missense unknown
R7517:Unc13b UTSW 4 43,215,765 (GRCm39) missense probably benign
R7532:Unc13b UTSW 4 43,249,565 (GRCm39) missense probably benign 0.44
R7564:Unc13b UTSW 4 43,091,258 (GRCm39) missense probably damaging 1.00
R7598:Unc13b UTSW 4 43,263,569 (GRCm39) missense probably benign 0.20
R7604:Unc13b UTSW 4 43,256,776 (GRCm39) missense possibly damaging 0.95
R7604:Unc13b UTSW 4 43,170,102 (GRCm39) missense unknown
R7643:Unc13b UTSW 4 43,216,333 (GRCm39) missense probably benign
R7718:Unc13b UTSW 4 43,173,854 (GRCm39) missense unknown
R7735:Unc13b UTSW 4 43,165,791 (GRCm39) missense probably damaging 1.00
R7756:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7757:Unc13b UTSW 4 43,177,341 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,330 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7758:Unc13b UTSW 4 43,177,344 (GRCm39) small insertion probably benign
R7758:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R7781:Unc13b UTSW 4 43,259,546 (GRCm39) missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43,172,737 (GRCm39) missense unknown
R7858:Unc13b UTSW 4 43,176,285 (GRCm39) missense unknown
R7867:Unc13b UTSW 4 43,232,573 (GRCm39) nonsense probably null
R7897:Unc13b UTSW 4 43,171,860 (GRCm39) missense unknown
R7904:Unc13b UTSW 4 43,217,075 (GRCm39) missense probably benign
R7929:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
R7984:Unc13b UTSW 4 43,173,973 (GRCm39) missense unknown
R8069:Unc13b UTSW 4 43,177,597 (GRCm39) missense unknown
R8101:Unc13b UTSW 4 43,239,918 (GRCm39) missense probably benign 0.08
R8289:Unc13b UTSW 4 43,172,524 (GRCm39) nonsense probably null
R8301:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
R8397:Unc13b UTSW 4 43,217,290 (GRCm39) missense probably benign 0.12
R8421:Unc13b UTSW 4 43,178,304 (GRCm39) missense unknown
R8738:Unc13b UTSW 4 43,177,564 (GRCm39) missense unknown
R8746:Unc13b UTSW 4 43,176,120 (GRCm39) missense unknown
R8766:Unc13b UTSW 4 43,174,722 (GRCm39) missense unknown
R8825:Unc13b UTSW 4 43,237,683 (GRCm39) splice site probably benign
R8834:Unc13b UTSW 4 43,175,954 (GRCm39) missense unknown
R8862:Unc13b UTSW 4 43,235,207 (GRCm39) missense probably damaging 1.00
R8864:Unc13b UTSW 4 43,174,724 (GRCm39) missense unknown
R8889:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8892:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8904:Unc13b UTSW 4 43,178,531 (GRCm39) intron probably benign
R9089:Unc13b UTSW 4 43,095,847 (GRCm39) missense probably damaging 1.00
R9144:Unc13b UTSW 4 43,173,649 (GRCm39) missense unknown
R9149:Unc13b UTSW 4 43,176,186 (GRCm39) missense unknown
R9173:Unc13b UTSW 4 43,177,421 (GRCm39) missense unknown
R9200:Unc13b UTSW 4 43,257,352 (GRCm39) missense possibly damaging 0.50
R9232:Unc13b UTSW 4 43,240,321 (GRCm39) missense probably benign 0.03
R9269:Unc13b UTSW 4 43,171,955 (GRCm39) missense unknown
R9320:Unc13b UTSW 4 43,171,044 (GRCm39) missense unknown
R9335:Unc13b UTSW 4 43,255,551 (GRCm39) missense probably damaging 0.99
R9335:Unc13b UTSW 4 43,216,123 (GRCm39) missense possibly damaging 0.86
R9352:Unc13b UTSW 4 43,177,313 (GRCm39) nonsense probably null
R9352:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R9378:Unc13b UTSW 4 43,173,282 (GRCm39) missense unknown
R9382:Unc13b UTSW 4 43,172,512 (GRCm39) missense unknown
R9569:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R9622:Unc13b UTSW 4 43,172,513 (GRCm39) missense
R9687:Unc13b UTSW 4 43,174,920 (GRCm39) missense unknown
R9704:Unc13b UTSW 4 43,237,102 (GRCm39) missense probably benign 0.31
R9721:Unc13b UTSW 4 43,101,869 (GRCm39) missense probably benign
R9753:Unc13b UTSW 4 43,182,842 (GRCm39) nonsense probably null
RF016:Unc13b UTSW 4 43,177,350 (GRCm39) small insertion probably benign
RF016:Unc13b UTSW 4 43,177,347 (GRCm39) small insertion probably benign
RF041:Unc13b UTSW 4 43,177,338 (GRCm39) small insertion probably benign
RF056:Unc13b UTSW 4 43,177,359 (GRCm39) small insertion probably benign
Z1176:Unc13b UTSW 4 43,177,764 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,177,191 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,171,419 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,261,043 (GRCm39) missense probably benign 0.11
Z1177:Unc13b UTSW 4 43,173,669 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGAATTGCCATCCAGAAGG -3'
(R):5'- ATACACCAGGAGCCATCTGC -3'

Sequencing Primer
(F):5'- GAAGGGCTGTTCACTCTT -3'
(R):5'- GCTCTTCATAAACTACTTGGTGGAC -3'
Posted On 2020-07-28