Incidental Mutation 'R8246:Tecrl'
ID640756
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Nametrans-2,3-enoyl-CoA reductase-like
SynonymsSrd5a2l2, D330017N19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R8246 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location83278145-83355195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83279309 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 331 (M331V)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
Predicted Effect probably damaging
Transcript: ENSMUST00000053543
AA Change: M331V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: M331V

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83294606 missense probably benign
IGL02067:Tecrl APN 5 83284275 missense probably benign 0.05
IGL02111:Tecrl APN 5 83354792 missense probably damaging 1.00
IGL02391:Tecrl APN 5 83354827 missense probably benign 0.00
IGL02860:Tecrl APN 5 83354997 missense probably benign 0.01
IGL03079:Tecrl APN 5 83294600 missense probably damaging 0.96
IGL03109:Tecrl APN 5 83309309 intron probably benign
BB004:Tecrl UTSW 5 83354819 missense probably damaging 1.00
BB014:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R0095:Tecrl UTSW 5 83294570 splice site probably benign
R0347:Tecrl UTSW 5 83294632 missense probably damaging 1.00
R0372:Tecrl UTSW 5 83294659 missense probably damaging 1.00
R0403:Tecrl UTSW 5 83354758 splice site probably benign
R0426:Tecrl UTSW 5 83354763 splice site probably benign
R0597:Tecrl UTSW 5 83354928 nonsense probably null
R1607:Tecrl UTSW 5 83280508 splice site probably null
R1771:Tecrl UTSW 5 83291287 missense probably damaging 1.00
R1800:Tecrl UTSW 5 83279230 missense probably damaging 1.00
R1815:Tecrl UTSW 5 83279234 missense probably benign 0.01
R1869:Tecrl UTSW 5 83354859 missense probably benign 0.00
R1870:Tecrl UTSW 5 83354859 missense probably benign 0.00
R4296:Tecrl UTSW 5 83313327 nonsense probably null
R4471:Tecrl UTSW 5 83313287 missense probably benign
R6281:Tecrl UTSW 5 83294606 missense probably damaging 1.00
R6343:Tecrl UTSW 5 83294600 missense probably damaging 0.96
R6866:Tecrl UTSW 5 83313314 missense probably damaging 1.00
R6948:Tecrl UTSW 5 83309250 missense probably benign
R6971:Tecrl UTSW 5 83354802 missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83354921 missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83279335 missense probably damaging 0.99
R7282:Tecrl UTSW 5 83354907 missense probably benign 0.26
R7444:Tecrl UTSW 5 83355068 unclassified probably benign
R7900:Tecrl UTSW 5 83279341 missense probably benign 0.04
R7927:Tecrl UTSW 5 83354819 missense probably damaging 1.00
R8360:Tecrl UTSW 5 83300917 missense probably damaging 1.00
X0019:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0024:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0034:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0035:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0036:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0037:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0038:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0039:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0040:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0052:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0053:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0054:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0058:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0060:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0061:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0062:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0063:Tecrl UTSW 5 83338252 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTCCTGGCAAATGTCAACACAC -3'
(R):5'- GCCATAGATAAAAGGGCCTTAATAG -3'

Sequencing Primer
(F):5'- TCCAAGGAAACGGTGTCTTC -3'
(R):5'- AGAATTCCTTCTTTCTACAGG -3'
Posted On2020-07-28