Incidental Mutation 'R8246:Tecrl'
ID 640756
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Name trans-2,3-enoyl-CoA reductase-like
Synonyms Srd5a2l2, D330017N19Rik
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 83425992-83503042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83427156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 331 (M331V)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
AlphaFold Q8BFZ1
Predicted Effect probably damaging
Transcript: ENSMUST00000053543
AA Change: M331V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: M331V

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Meta Mutation Damage Score 0.5341 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83,442,453 (GRCm39) missense probably benign
IGL02067:Tecrl APN 5 83,432,122 (GRCm39) missense probably benign 0.05
IGL02111:Tecrl APN 5 83,502,639 (GRCm39) missense probably damaging 1.00
IGL02391:Tecrl APN 5 83,502,674 (GRCm39) missense probably benign 0.00
IGL02860:Tecrl APN 5 83,502,844 (GRCm39) missense probably benign 0.01
IGL03079:Tecrl APN 5 83,442,447 (GRCm39) missense probably damaging 0.96
IGL03109:Tecrl APN 5 83,457,156 (GRCm39) intron probably benign
gaudenz UTSW 5 83,457,049 (GRCm39) critical splice donor site probably null
Whoopie UTSW 5 83,442,453 (GRCm39) missense probably damaging 1.00
BB004:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
BB014:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
R0095:Tecrl UTSW 5 83,442,417 (GRCm39) splice site probably benign
R0347:Tecrl UTSW 5 83,442,479 (GRCm39) missense probably damaging 1.00
R0372:Tecrl UTSW 5 83,442,506 (GRCm39) missense probably damaging 1.00
R0403:Tecrl UTSW 5 83,502,605 (GRCm39) splice site probably benign
R0426:Tecrl UTSW 5 83,502,610 (GRCm39) splice site probably benign
R0597:Tecrl UTSW 5 83,502,775 (GRCm39) nonsense probably null
R1607:Tecrl UTSW 5 83,428,355 (GRCm39) splice site probably null
R1771:Tecrl UTSW 5 83,439,134 (GRCm39) missense probably damaging 1.00
R1800:Tecrl UTSW 5 83,427,077 (GRCm39) missense probably damaging 1.00
R1815:Tecrl UTSW 5 83,427,081 (GRCm39) missense probably benign 0.01
R1869:Tecrl UTSW 5 83,502,706 (GRCm39) missense probably benign 0.00
R1870:Tecrl UTSW 5 83,502,706 (GRCm39) missense probably benign 0.00
R4296:Tecrl UTSW 5 83,461,174 (GRCm39) nonsense probably null
R4471:Tecrl UTSW 5 83,461,134 (GRCm39) missense probably benign
R6281:Tecrl UTSW 5 83,442,453 (GRCm39) missense probably damaging 1.00
R6343:Tecrl UTSW 5 83,442,447 (GRCm39) missense probably damaging 0.96
R6866:Tecrl UTSW 5 83,461,161 (GRCm39) missense probably damaging 1.00
R6948:Tecrl UTSW 5 83,457,097 (GRCm39) missense probably benign
R6971:Tecrl UTSW 5 83,502,649 (GRCm39) missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83,502,768 (GRCm39) missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83,427,182 (GRCm39) missense probably damaging 0.99
R7282:Tecrl UTSW 5 83,502,754 (GRCm39) missense probably benign 0.26
R7444:Tecrl UTSW 5 83,502,915 (GRCm39) unclassified probably benign
R7900:Tecrl UTSW 5 83,427,188 (GRCm39) missense probably benign 0.04
R7927:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
R8360:Tecrl UTSW 5 83,448,764 (GRCm39) missense probably damaging 1.00
R8466:Tecrl UTSW 5 83,428,367 (GRCm39) nonsense probably null
R8947:Tecrl UTSW 5 83,461,154 (GRCm39) missense probably benign 0.10
R8949:Tecrl UTSW 5 83,461,154 (GRCm39) missense probably benign 0.10
R9009:Tecrl UTSW 5 83,432,121 (GRCm39) missense probably damaging 0.96
R9115:Tecrl UTSW 5 83,427,906 (GRCm39) missense possibly damaging 0.93
R9182:Tecrl UTSW 5 83,457,049 (GRCm39) critical splice donor site probably null
R9320:Tecrl UTSW 5 83,428,422 (GRCm39) missense possibly damaging 0.67
X0019:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0024:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0034:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0035:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0036:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0037:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0038:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0039:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0040:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0052:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0053:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0054:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0058:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0060:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0061:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0062:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0063:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTCCTGGCAAATGTCAACACAC -3'
(R):5'- GCCATAGATAAAAGGGCCTTAATAG -3'

Sequencing Primer
(F):5'- TCCAAGGAAACGGTGTCTTC -3'
(R):5'- AGAATTCCTTCTTTCTACAGG -3'
Posted On 2020-07-28