Mutagenetix > Incidental Mutation

Incidental Mutation 'R0096:Pygl'

64076

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

038382-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R0096 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 70191166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably benign
Transcript: ENSMUST00000071250

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161083

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.5%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	C	6: 48,931,188	Q374P	probably damaging	Het
4933405L10Rik	A	T	8: 105,708,931		probably null	Het
Adamts3	G	A	5: 89,701,717	Q615*	probably null	Het
Adamtsl3	T	A	7: 82,465,699		probably benign	Het
Anks1b	T	C	10: 90,074,062	S48P	possibly damaging	Het
Arfip2	T	A	7: 105,638,230	K94N	probably damaging	Het
Arhgap42	G	T	9: 9,009,313	N524K	probably damaging	Het
Arhgef28	T	G	13: 97,931,254	T1388P	probably damaging	Het
Arid4b	T	C	13: 14,129,194	V68A	probably benign	Het
BC005537	T	C	13: 24,805,940	F129L	probably damaging	Het
Capn3	A	T	2: 120,502,529	H592L	possibly damaging	Het
Ccdc105	T	A	10: 78,748,705	I328L	probably benign	Het
Dglucy	A	T	12: 100,838,651	I134F	possibly damaging	Het
Dhh	T	A	15: 98,893,988	M380L	probably benign	Het
Dnaic2	A	C	11: 114,754,332	D531A	probably benign	Het
Dthd1	A	T	5: 62,843,040	R568S	possibly damaging	Het
Efr3a	A	G	15: 65,855,441	N613S	probably damaging	Het
Epb41l5	T	A	1: 119,623,911		probably benign	Het
Ermp1	A	G	19: 29,631,388	Y164H	possibly damaging	Het
Fam120c	CCAGCAGCAGCAGCAGCA	CCAGCAGCAGCAGCA	X: 151,344,345		probably benign	Het
Fbrs	C	T	7: 127,489,487	A145V	probably damaging	Het
Gm4736	T	C	6: 132,115,606		noncoding transcript	Het
Gm9873	A	T	2: 169,021,109		noncoding transcript	Het
Grik1	T	C	16: 88,034,226	M219V	possibly damaging	Het
Gtsf1l	C	T	2: 163,087,536	C9Y	probably damaging	Het
Itih5	G	A	2: 10,251,378	R885Q	probably benign	Het
Kdm4c	A	G	4: 74,357,343	E752G	probably damaging	Het
Ksr1	A	G	11: 79,038,247		probably benign	Het
Lama1	T	A	17: 67,805,413	F2283I	probably benign	Het
Luc7l3	A	G	11: 94,301,494		probably benign	Het
Lypd8	A	T	11: 58,386,757	M122L	probably benign	Het
Map1a	A	G	2: 121,301,505	E696G	probably damaging	Het
Mrps34	A	G	17: 24,895,669	D110G	probably damaging	Het
Myh11	T	A	16: 14,204,367	K1710M	possibly damaging	Het
Myo1d	A	G	11: 80,484,332	L972P	probably damaging	Het
Nos1ap	T	C	1: 170,329,247	D214G	probably damaging	Het
Olfr1224-ps1	A	T	2: 89,156,296	M293K	probably benign	Het
Olfr910	A	T	9: 38,539,536	I214F	probably damaging	Het
Pate4	T	G	9: 35,611,834	T5P	probably damaging	Het
Samd4	A	T	14: 47,064,297	M252L	possibly damaging	Het
Serpinb1c	T	A	13: 32,886,283		probably benign	Het
Sis	A	T	3: 72,928,267	W921R	probably damaging	Het
Skint5	A	T	4: 113,597,768		probably benign	Het
Slc27a6	T	C	18: 58,598,757		probably benign	Het
Sycp2	G	T	2: 178,403,735	Q31K	probably damaging	Het
Taar7f	A	G	10: 24,050,254	M249V	probably benign	Het
Tarm1	T	C	7: 3,497,551	T79A	probably benign	Het
Trf	A	G	9: 103,222,159	F300L	probably damaging	Het
Vmn1r69	T	A	7: 10,580,058	I170F	probably damaging	Het
Vmn2r105	A	G	17: 20,227,479	F361S	possibly damaging	Het
Vmn2r79	A	G	7: 87,037,319	Y636C	probably damaging	Het
Wdr59	T	C	8: 111,504,373	N68D	probably damaging	Het
Zfp345	T	A	2: 150,472,300	H439L	probably damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCTGGACTCGTTGGATAGGGAAATC -3'
(R):5'- AGCACGGAGAATATGGCTTACATGG -3'

Sequencing Primer
(F):5'- ATCTTCAGATCCGAAGGCTC -3'
(R):5'- ctctctctctctctctctctctc -3'

Posted On

2013-08-06