Incidental Mutation 'R8246:Alpk3'
ID640760
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Namealpha-kinase 3
SynonymsMidori
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R8246 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81057600-81105612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81092776 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 780 (D780E)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
Predicted Effect probably benign
Transcript: ENSMUST00000107348
AA Change: D780E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: D780E

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGCATTCCTGTAGCTTTC -3'
(R):5'- TTGAATGCCCACCAGAGAGAC -3'

Sequencing Primer
(F):5'- TGTAGCTTTCGAAACCCAATCAGAG -3'
(R):5'- ACATGAAGCGGTTCCTGG -3'
Posted On2020-07-28