Incidental Mutation 'R8246:Tmem184c'
ID640763
Institutional Source Beutler Lab
Gene Symbol Tmem184c
Ensembl Gene ENSMUSG00000031617
Gene Nametransmembrane protein 184C
SynonymsTmem34, 8430433H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R8246 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location77595982-77610698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77610185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 14 (I14N)
Ref Sequence ENSEMBL: ENSMUSP00000034030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034030] [ENSMUST00000141202] [ENSMUST00000152168]
Predicted Effect probably damaging
Transcript: ENSMUST00000034030
AA Change: I14N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617
AA Change: I14N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141202
AA Change: I55N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120041
Gene: ENSMUSG00000031617
AA Change: I55N

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152168
AA Change: I54N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114463
Gene: ENSMUSG00000031617
AA Change: I54N

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Pfam:Solute_trans_a 85 228 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Ccdc42 C A 11: 68,587,296 Q28K probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Tmem184c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Tmem184c APN 8 77597146 nonsense probably null
IGL02024:Tmem184c APN 8 77604814 missense probably benign 0.10
IGL02231:Tmem184c APN 8 77604812 missense probably damaging 1.00
IGL02736:Tmem184c APN 8 77597846 missense probably damaging 1.00
IGL02934:Tmem184c APN 8 77597820 missense probably damaging 1.00
IGL03046:Tmem184c UTSW 8 77599657 nonsense probably null
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0189:Tmem184c UTSW 8 77597812 missense possibly damaging 0.92
R0564:Tmem184c UTSW 8 77606160 unclassified probably null
R0946:Tmem184c UTSW 8 77604757 missense probably damaging 1.00
R1629:Tmem184c UTSW 8 77602922 missense possibly damaging 0.87
R1629:Tmem184c UTSW 8 77606162 critical splice donor site probably null
R2261:Tmem184c UTSW 8 77597043 missense probably damaging 1.00
R2261:Tmem184c UTSW 8 77597175 missense probably damaging 0.99
R2919:Tmem184c UTSW 8 77604647 missense probably damaging 1.00
R3805:Tmem184c UTSW 8 77596875 missense unknown
R5418:Tmem184c UTSW 8 77597820 missense probably damaging 1.00
R5716:Tmem184c UTSW 8 77606407 missense possibly damaging 0.90
R5934:Tmem184c UTSW 8 77604723 nonsense probably null
R5951:Tmem184c UTSW 8 77598662 splice site probably null
R6150:Tmem184c UTSW 8 77596440 missense probably benign 0.04
R7206:Tmem184c UTSW 8 77596577 missense possibly damaging 0.46
R7387:Tmem184c UTSW 8 77597930 nonsense probably null
R7899:Tmem184c UTSW 8 77597811 missense probably damaging 1.00
R7959:Tmem184c UTSW 8 77602903 missense possibly damaging 0.94
R8100:Tmem184c UTSW 8 77604782 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGTTTAATGTCCACAGACGAAATG -3'
(R):5'- GTTTACCCTGATAGTCCTCGG -3'

Sequencing Primer
(F):5'- CACAGACGAAATGTTTTTCAGACCTC -3'
(R):5'- ATAGTCCTCGGGGTCACGATG -3'
Posted On2020-07-28