Incidental Mutation 'R8246:Ccdc42'
ID640769
Institutional Source Beutler Lab
Gene Symbol Ccdc42
Ensembl Gene ENSMUSG00000045915
Gene Namecoiled-coil domain containing 42
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8246 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68587021-68597966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68587296 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 28 (Q28K)
Ref Sequence ENSEMBL: ENSMUSP00000114381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063006] [ENSMUST00000154294]
Predicted Effect probably benign
Transcript: ENSMUST00000063006
AA Change: Q24K

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057342
Gene: ENSMUSG00000045915
AA Change: Q24K

DomainStartEndE-ValueType
Pfam:DUF4200 39 169 6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154294
AA Change: Q28K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114381
Gene: ENSMUSG00000045915
AA Change: Q28K

DomainStartEndE-ValueType
Pfam:DUF4200 44 162 5.6e-30 PFAM
coiled coil region 182 239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no overt behavioral deficits. Males exhibit defects in the number and location of the sperm head-tail coupling apparatus, lack flagellated sperm, and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,446,966 V810A probably benign Het
Alpk3 C A 7: 81,092,776 D780E probably benign Het
Anln A C 9: 22,350,955 S947A probably benign Het
Borcs6 C T 11: 69,060,551 P252S probably benign Het
Ccdc109b C A 3: 129,915,165 V328L probably benign Het
Cp A G 3: 19,975,022 I554M probably damaging Het
Dnm3 T G 1: 162,307,917 D429A probably damaging Het
Dok5 A G 2: 170,800,893 K37R probably benign Het
Dtwd2 A T 18: 49,698,425 Y268N probably benign Het
Eif3a T C 19: 60,779,368 E244G probably damaging Het
Fam149a T C 8: 45,381,618 E48G probably benign Het
Fam160a2 T C 7: 105,389,660 E124G probably damaging Het
Fam186a T A 15: 99,940,547 E2605D unknown Het
Fyn T A 10: 39,529,529 W264R probably damaging Het
Gm10024 T A 10: 77,711,535 S27T unknown Het
Gpr157 C T 4: 150,102,296 L294F possibly damaging Het
Kif6 C T 17: 49,758,514 Q506* probably null Het
Loxhd1 A G 18: 77,363,546 K707R possibly damaging Het
Mdn1 C T 4: 32,657,284 P12S probably benign Het
Mrgprb3 T G 7: 48,643,520 L94F probably benign Het
Mycbp2 G T 14: 103,155,204 P3307Q probably damaging Het
Olfr1308 T C 2: 111,960,138 I312V probably benign Het
Olfr744 A G 14: 50,618,384 Y54C probably benign Het
Rmdn2 T A 17: 79,672,537 C381* probably null Het
Rpusd4 A G 9: 35,272,580 I202V probably benign Het
Shank3 A T 15: 89,533,346 R49W possibly damaging Het
Smurf2 T C 11: 106,831,044 T542A probably benign Het
Sorcs2 G A 5: 36,062,588 R371C probably damaging Het
Sqstm1 T C 11: 50,210,561 H66R probably damaging Het
Stard8 C T X: 99,065,964 S155L probably benign Het
Svep1 A T 4: 58,091,889 V1582D probably damaging Het
Tecrl T C 5: 83,279,309 M331V probably damaging Het
Tinf2 T C 14: 55,679,585 S368G probably damaging Het
Tmem184c A T 8: 77,610,185 I14N probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Vps16 G C 2: 130,438,873 G241R probably damaging Het
Ythdc1 C T 5: 86,817,322 T292I possibly damaging Het
Other mutations in Ccdc42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ccdc42 APN 11 68594621 missense probably benign 0.09
IGL01897:Ccdc42 APN 11 68594275 missense probably benign 0.00
R0153:Ccdc42 UTSW 11 68587650 missense possibly damaging 0.56
R0540:Ccdc42 UTSW 11 68597710 nonsense probably null
R0607:Ccdc42 UTSW 11 68597710 nonsense probably null
R1619:Ccdc42 UTSW 11 68594289 missense probably damaging 0.97
R1831:Ccdc42 UTSW 11 68590979 missense probably benign 0.00
R2264:Ccdc42 UTSW 11 68587651 missense probably benign 0.03
R6307:Ccdc42 UTSW 11 68588280 missense probably damaging 1.00
R6352:Ccdc42 UTSW 11 68594365 missense probably damaging 1.00
R6522:Ccdc42 UTSW 11 68588220 missense probably damaging 1.00
R7009:Ccdc42 UTSW 11 68594616 missense probably damaging 0.99
R7262:Ccdc42 UTSW 11 68594573 missense probably damaging 1.00
R7813:Ccdc42 UTSW 11 68597708 missense probably benign 0.00
R7827:Ccdc42 UTSW 11 68594196 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTGGGACTTTGAAAGCAGC -3'
(R):5'- AAGAGGTCTCCACTCTCACC -3'

Sequencing Primer
(F):5'- GGAGACCGAGAATCCAGCC -3'
(R):5'- GGTCTCCACTCTCACCTTAATGAAAG -3'
Posted On2020-07-28