Incidental Mutation 'R8246:Or11g2'
ID 640772
Institutional Source Beutler Lab
Gene Symbol Or11g2
Ensembl Gene ENSMUSG00000053815
Gene Name olfactory receptor family 11 subfamily G member 2
Synonyms MOR106-13P, GA_x6K02T2PMLR-6326342-6327313, Olfr744
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50855681-50856652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50855841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000066496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066457]
AlphaFold Q7TRM0
Predicted Effect probably benign
Transcript: ENSMUST00000066457
AA Change: Y54C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066496
Gene: ENSMUSG00000053815
AA Change: Y54C

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.9e-48 PFAM
Pfam:7tm_1 45 294 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Or11g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Or11g2 APN 14 50,856,069 (GRCm39) missense probably damaging 1.00
IGL02136:Or11g2 APN 14 50,855,708 (GRCm39) missense possibly damaging 0.86
IGL02165:Or11g2 APN 14 50,856,468 (GRCm39) missense probably damaging 1.00
IGL02207:Or11g2 APN 14 50,856,015 (GRCm39) missense probably damaging 1.00
IGL02556:Or11g2 APN 14 50,856,185 (GRCm39) missense probably benign 0.01
IGL02710:Or11g2 APN 14 50,856,255 (GRCm39) missense probably benign 0.02
R0127:Or11g2 UTSW 14 50,855,789 (GRCm39) missense probably benign
R0389:Or11g2 UTSW 14 50,856,036 (GRCm39) missense probably damaging 1.00
R0603:Or11g2 UTSW 14 50,855,967 (GRCm39) missense probably damaging 1.00
R0927:Or11g2 UTSW 14 50,856,044 (GRCm39) missense possibly damaging 0.47
R1477:Or11g2 UTSW 14 50,856,170 (GRCm39) missense probably damaging 0.98
R1705:Or11g2 UTSW 14 50,856,579 (GRCm39) missense probably benign 0.01
R1800:Or11g2 UTSW 14 50,856,143 (GRCm39) missense probably benign 0.01
R1898:Or11g2 UTSW 14 50,856,231 (GRCm39) missense probably damaging 1.00
R2244:Or11g2 UTSW 14 50,856,114 (GRCm39) missense probably damaging 1.00
R4731:Or11g2 UTSW 14 50,856,026 (GRCm39) missense probably benign 0.11
R4732:Or11g2 UTSW 14 50,856,026 (GRCm39) missense probably benign 0.11
R4733:Or11g2 UTSW 14 50,856,026 (GRCm39) missense probably benign 0.11
R4801:Or11g2 UTSW 14 50,856,479 (GRCm39) missense probably benign 0.01
R4802:Or11g2 UTSW 14 50,856,479 (GRCm39) missense probably benign 0.01
R5068:Or11g2 UTSW 14 50,856,197 (GRCm39) missense probably damaging 1.00
R5069:Or11g2 UTSW 14 50,856,197 (GRCm39) missense probably damaging 1.00
R5070:Or11g2 UTSW 14 50,856,197 (GRCm39) missense probably damaging 1.00
R5070:Or11g2 UTSW 14 50,855,931 (GRCm39) missense probably benign 0.11
R5195:Or11g2 UTSW 14 50,856,243 (GRCm39) missense probably damaging 1.00
R6058:Or11g2 UTSW 14 50,856,158 (GRCm39) missense probably benign 0.03
R8275:Or11g2 UTSW 14 50,855,868 (GRCm39) missense probably damaging 1.00
R9292:Or11g2 UTSW 14 50,856,513 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTACTTTCACAGGGTACAGAC -3'
(R):5'- GATCAAATGCCATGACTGCC -3'

Sequencing Primer
(F):5'- TACTTTCACAGGGTACAGACAGATG -3'
(R):5'- CTGCCAGGAAAAAGCATTCTG -3'
Posted On 2020-07-28