Incidental Mutation 'R8246:Mycbp2'
ID 640774
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene Name MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms Phr1, Pam, C130061D10Rik
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103350847-103584250 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103392640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 3307 (P3307Q)
Ref Sequence ENSEMBL: ENSMUSP00000124710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000159855
AA Change: P3307Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: P3307Q

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160758
AA Change: P3197Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: P3197Q

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124443
Gene: ENSMUSG00000033004
AA Change: P20Q

DomainStartEndE-ValueType
low complexity region 66 79 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
low complexity region 392 409 N/A INTRINSIC
APC10 524 682 1.11e-18 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
Blast:BBOX 1042 1085 2e-6 BLAST
RING 1213 1263 5.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161278
SMART Domains Protein: ENSMUSP00000125189
Gene: ENSMUSG00000033004

DomainStartEndE-ValueType
Blast:IG_FLMN 2 66 1e-37 BLAST
SCOP:d1qfha1 14 64 2e-7 SMART
Pfam:SH3_3 98 165 5.8e-10 PFAM
internal_repeat_1 213 280 8.77e-8 PROSPERO
low complexity region 302 311 N/A INTRINSIC
low complexity region 485 518 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Loxhd1 A G 18: 77,451,242 (GRCm39) K707R possibly damaging Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103,460,486 (GRCm39) missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103,393,244 (GRCm39) missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103,438,788 (GRCm39) missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103,432,057 (GRCm39) missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103,364,189 (GRCm39) missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103,528,719 (GRCm39) splice site probably benign
IGL00960:Mycbp2 APN 14 103,466,820 (GRCm39) missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103,410,078 (GRCm39) missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103,359,983 (GRCm39) missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103,392,946 (GRCm39) missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103,466,928 (GRCm39) splice site probably null
IGL01586:Mycbp2 APN 14 103,378,305 (GRCm39) critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103,528,723 (GRCm39) critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103,365,415 (GRCm39) missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103,372,640 (GRCm39) nonsense probably null
IGL01820:Mycbp2 APN 14 103,425,937 (GRCm39) missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103,380,647 (GRCm39) missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103,392,343 (GRCm39) nonsense probably null
IGL02178:Mycbp2 APN 14 103,461,802 (GRCm39) missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103,479,643 (GRCm39) missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103,551,811 (GRCm39) missense probably benign
IGL02607:Mycbp2 APN 14 103,522,709 (GRCm39) missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103,442,621 (GRCm39) missense probably benign
IGL02702:Mycbp2 APN 14 103,457,560 (GRCm39) missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103,392,697 (GRCm39) missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103,351,678 (GRCm39) splice site probably benign
IGL02866:Mycbp2 APN 14 103,367,428 (GRCm39) missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103,414,715 (GRCm39) missense probably benign
IGL03082:Mycbp2 APN 14 103,441,805 (GRCm39) missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103,536,212 (GRCm39) missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103,392,889 (GRCm39) missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103,536,134 (GRCm39) missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103,426,025 (GRCm39) missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103,485,194 (GRCm39) missense probably damaging 1.00
compost UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
decompose UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
moulder UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103,461,898 (GRCm39) splice site probably benign
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103,389,578 (GRCm39) missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103,394,070 (GRCm39) unclassified probably benign
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103,551,761 (GRCm39) nonsense probably null
R0388:Mycbp2 UTSW 14 103,394,103 (GRCm39) missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103,372,569 (GRCm39) missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103,419,895 (GRCm39) missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103,433,827 (GRCm39) unclassified probably benign
R0671:Mycbp2 UTSW 14 103,432,024 (GRCm39) missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103,412,230 (GRCm39) missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103,457,449 (GRCm39) missense probably benign
R0903:Mycbp2 UTSW 14 103,513,293 (GRCm39) missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103,500,129 (GRCm39) unclassified probably benign
R0961:Mycbp2 UTSW 14 103,422,271 (GRCm39) missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103,378,353 (GRCm39) missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103,412,262 (GRCm39) missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103,437,588 (GRCm39) nonsense probably null
R1211:Mycbp2 UTSW 14 103,357,999 (GRCm39) missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103,446,218 (GRCm39) missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103,393,334 (GRCm39) missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103,536,303 (GRCm39) splice site probably benign
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103,441,825 (GRCm39) missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103,470,033 (GRCm39) missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103,407,287 (GRCm39) splice site probably null
R1565:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103,485,194 (GRCm39) missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103,464,947 (GRCm39) missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103,461,852 (GRCm39) missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103,419,855 (GRCm39) missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103,393,150 (GRCm39) missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103,422,319 (GRCm39) missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103,466,840 (GRCm39) missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103,383,407 (GRCm39) missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103,485,839 (GRCm39) missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103,497,675 (GRCm39) missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103,469,960 (GRCm39) critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103,524,696 (GRCm39) missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103,457,512 (GRCm39) missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103,438,666 (GRCm39) missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,383,378 (GRCm39) missense probably benign
R2146:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103,407,291 (GRCm39) critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103,407,295 (GRCm39) missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103,500,185 (GRCm39) missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103,381,774 (GRCm39) missense probably null 0.66
R2379:Mycbp2 UTSW 14 103,412,386 (GRCm39) missense probably benign
R2495:Mycbp2 UTSW 14 103,437,554 (GRCm39) missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103,368,681 (GRCm39) missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103,392,691 (GRCm39) missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103,534,794 (GRCm39) missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103,446,179 (GRCm39) splice site probably benign
R3404:Mycbp2 UTSW 14 103,437,550 (GRCm39) missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103,372,553 (GRCm39) missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103,466,866 (GRCm39) missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103,393,850 (GRCm39) missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103,371,224 (GRCm39) missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103,434,721 (GRCm39) missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103,412,233 (GRCm39) missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103,364,149 (GRCm39) missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103,441,936 (GRCm39) missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103,532,688 (GRCm39) missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103,376,161 (GRCm39) splice site probably benign
R4021:Mycbp2 UTSW 14 103,389,593 (GRCm39) missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103,485,893 (GRCm39) missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103,360,881 (GRCm39) missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103,524,664 (GRCm39) missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103,372,702 (GRCm39) missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103,371,225 (GRCm39) missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103,425,938 (GRCm39) missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103,393,094 (GRCm39) missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103,583,733 (GRCm39) missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103,414,749 (GRCm39) missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103,426,027 (GRCm39) missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103,457,380 (GRCm39) missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103,466,873 (GRCm39) missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103,448,731 (GRCm39) missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103,383,382 (GRCm39) missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103,524,675 (GRCm39) missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103,497,821 (GRCm39) splice site probably null
R4994:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign
R5029:Mycbp2 UTSW 14 103,393,946 (GRCm39) missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103,534,375 (GRCm39) missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103,376,671 (GRCm39) critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103,583,650 (GRCm39) critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103,583,757 (GRCm39) missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103,423,119 (GRCm39) critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103,479,868 (GRCm39) nonsense probably null
R5414:Mycbp2 UTSW 14 103,543,697 (GRCm39) missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103,438,837 (GRCm39) missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103,437,562 (GRCm39) missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103,479,615 (GRCm39) missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103,411,250 (GRCm39) missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103,532,673 (GRCm39) missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103,520,081 (GRCm39) nonsense probably null
R5569:Mycbp2 UTSW 14 103,372,679 (GRCm39) missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103,380,203 (GRCm39) missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103,528,769 (GRCm39) missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103,432,113 (GRCm39) missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103,426,051 (GRCm39) critical splice acceptor site probably null
R5645:Mycbp2 UTSW 14 103,426,044 (GRCm39) missense probably damaging 1.00
R5646:Mycbp2 UTSW 14 103,407,346 (GRCm39) missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103,528,778 (GRCm39) missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103,520,101 (GRCm39) missense probably null 0.99
R5668:Mycbp2 UTSW 14 103,357,955 (GRCm39) missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103,385,986 (GRCm39) missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103,371,410 (GRCm39) missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103,361,839 (GRCm39) missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103,364,120 (GRCm39) missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103,394,159 (GRCm39) missense probably benign
R6063:Mycbp2 UTSW 14 103,372,582 (GRCm39) missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103,460,482 (GRCm39) missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103,513,323 (GRCm39) missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103,522,836 (GRCm39) missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103,392,945 (GRCm39) nonsense probably null
R6161:Mycbp2 UTSW 14 103,536,183 (GRCm39) missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103,384,453 (GRCm39) missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103,497,665 (GRCm39) missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103,392,862 (GRCm39) missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103,500,176 (GRCm39) missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103,393,288 (GRCm39) missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103,392,911 (GRCm39) missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103,373,993 (GRCm39) critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103,380,317 (GRCm39) missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103,429,003 (GRCm39) missense probably null 1.00
R6821:Mycbp2 UTSW 14 103,376,845 (GRCm39) missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103,497,630 (GRCm39) critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103,522,703 (GRCm39) missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103,392,342 (GRCm39) missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103,444,117 (GRCm39) missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103,412,417 (GRCm39) missense probably benign
R7054:Mycbp2 UTSW 14 103,393,534 (GRCm39) missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103,360,039 (GRCm39) missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103,391,513 (GRCm39) missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103,520,115 (GRCm39) missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103,497,636 (GRCm39) missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103,371,282 (GRCm39) missense probably benign
R7234:Mycbp2 UTSW 14 103,452,773 (GRCm39) missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103,393,733 (GRCm39) missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103,446,345 (GRCm39) missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103,434,679 (GRCm39) critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103,358,027 (GRCm39) missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103,434,793 (GRCm39) missense probably damaging 0.97
R7332:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
R7384:Mycbp2 UTSW 14 103,513,829 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,480,564 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,389,627 (GRCm39) missense probably damaging 1.00
R7409:Mycbp2 UTSW 14 103,526,180 (GRCm39) missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103,434,690 (GRCm39) missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103,583,701 (GRCm39) missense probably benign
R7661:Mycbp2 UTSW 14 103,450,059 (GRCm39) missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103,429,045 (GRCm39) missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103,429,055 (GRCm39) missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103,485,840 (GRCm39) missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103,364,533 (GRCm39) missense probably damaging 1.00
R7822:Mycbp2 UTSW 14 103,376,851 (GRCm39) missense probably benign 0.00
R7838:Mycbp2 UTSW 14 103,414,729 (GRCm39) missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103,384,267 (GRCm39) critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103,393,741 (GRCm39) missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103,393,582 (GRCm39) missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103,437,621 (GRCm39) missense probably damaging 0.99
R7942:Mycbp2 UTSW 14 103,392,674 (GRCm39) missense probably damaging 0.99
R7951:Mycbp2 UTSW 14 103,452,898 (GRCm39) missense probably damaging 0.99
R7958:Mycbp2 UTSW 14 103,367,400 (GRCm39) missense probably benign 0.00
R8235:Mycbp2 UTSW 14 103,436,110 (GRCm39) missense probably damaging 0.99
R8338:Mycbp2 UTSW 14 103,372,701 (GRCm39) missense probably damaging 1.00
R8343:Mycbp2 UTSW 14 103,398,111 (GRCm39) splice site probably null
R8361:Mycbp2 UTSW 14 103,376,250 (GRCm39) missense probably damaging 1.00
R8490:Mycbp2 UTSW 14 103,446,267 (GRCm39) missense probably benign 0.00
R8524:Mycbp2 UTSW 14 103,392,895 (GRCm39) missense probably benign 0.23
R8525:Mycbp2 UTSW 14 103,450,155 (GRCm39) missense probably damaging 1.00
R8711:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign 0.08
R8735:Mycbp2 UTSW 14 103,460,586 (GRCm39) missense probably damaging 0.99
R8825:Mycbp2 UTSW 14 103,466,871 (GRCm39) missense probably damaging 1.00
R8928:Mycbp2 UTSW 14 103,393,781 (GRCm39) missense probably benign
R8974:Mycbp2 UTSW 14 103,361,857 (GRCm39) missense probably damaging 1.00
R8987:Mycbp2 UTSW 14 103,446,232 (GRCm39) missense probably damaging 1.00
R9021:Mycbp2 UTSW 14 103,551,752 (GRCm39) missense probably benign 0.08
R9062:Mycbp2 UTSW 14 103,479,796 (GRCm39) missense probably benign 0.00
R9077:Mycbp2 UTSW 14 103,469,974 (GRCm39) missense probably damaging 1.00
R9208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.01
R9285:Mycbp2 UTSW 14 103,434,753 (GRCm39) missense probably damaging 0.97
R9290:Mycbp2 UTSW 14 103,425,960 (GRCm39) missense probably damaging 0.99
R9362:Mycbp2 UTSW 14 103,497,642 (GRCm39) missense probably damaging 0.97
R9520:Mycbp2 UTSW 14 103,497,705 (GRCm39) missense probably benign 0.02
R9557:Mycbp2 UTSW 14 103,372,697 (GRCm39) missense probably benign 0.03
R9639:Mycbp2 UTSW 14 103,433,817 (GRCm39) missense probably damaging 1.00
R9666:Mycbp2 UTSW 14 103,371,474 (GRCm39) missense probably damaging 0.98
R9732:Mycbp2 UTSW 14 103,448,749 (GRCm39) missense probably damaging 1.00
R9736:Mycbp2 UTSW 14 103,434,852 (GRCm39) missense probably damaging 0.96
R9739:Mycbp2 UTSW 14 103,520,229 (GRCm39) missense probably benign 0.11
R9755:Mycbp2 UTSW 14 103,551,806 (GRCm39) missense probably benign
X0024:Mycbp2 UTSW 14 103,384,378 (GRCm39) missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103,583,685 (GRCm39) missense probably benign
Z1176:Mycbp2 UTSW 14 103,394,073 (GRCm39) missense probably benign 0.06
Z1177:Mycbp2 UTSW 14 103,407,309 (GRCm39) missense possibly damaging 0.83
Z1177:Mycbp2 UTSW 14 103,372,559 (GRCm39) missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103,364,499 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCGAGCAAGTACCTAACTG -3'
(R):5'- AGTGGCTTTCTGGGAAGATATC -3'

Sequencing Primer
(F):5'- GCAAGTACCTAACTGTTTAAAAGGTG -3'
(R):5'- TGGCTACAATCAAAGCTGCTTC -3'
Posted On 2020-07-28