Mutagenetix > Incidental Mutation

Incidental Mutation 'R8246:Loxhd1'

640780

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R8246 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77363546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 707 (K707R)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

probably benign
Transcript: ENSMUST00000035501
AA Change: K474R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818
AA Change: K474R

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	53	3.2e-7	PFAM
LH2	63	176	1.1e-4	SMART
LH2	192	306	4.02e-4	SMART
LH2	320	442	3.79e-6	SMART
LH2	451	567	5.92e-6	SMART
LH2	581	696	7.67e-3	SMART
LH2	793	913	1.47e-11	SMART
low complexity region	922	931	N/A	INTRINSIC
SCOP:d1lox_2	949	974	1e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096547
AA Change: K707R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: K707R

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000148341
AA Change: K388R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: K388R

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Meta Mutation Damage Score

0.1076

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	T	C	5: 9,446,966	V810A	probably benign	Het
Alpk3	C	A	7: 81,092,776	D780E	probably benign	Het
Anln	A	C	9: 22,350,955	S947A	probably benign	Het
Borcs6	C	T	11: 69,060,551	P252S	probably benign	Het
Ccdc109b	C	A	3: 129,915,165	V328L	probably benign	Het
Ccdc42	C	A	11: 68,587,296	Q28K	probably benign	Het
Cp	A	G	3: 19,975,022	I554M	probably damaging	Het
Dnm3	T	G	1: 162,307,917	D429A	probably damaging	Het
Dok5	A	G	2: 170,800,893	K37R	probably benign	Het
Dtwd2	A	T	18: 49,698,425	Y268N	probably benign	Het
Eif3a	T	C	19: 60,779,368	E244G	probably damaging	Het
Fam149a	T	C	8: 45,381,618	E48G	probably benign	Het
Fam160a2	T	C	7: 105,389,660	E124G	probably damaging	Het
Fam186a	T	A	15: 99,940,547	E2605D	unknown	Het
Fyn	T	A	10: 39,529,529	W264R	probably damaging	Het
Gm10024	T	A	10: 77,711,535	S27T	unknown	Het
Gm156	A	G	6: 129,775,376		probably benign	Het
Gpr157	C	T	4: 150,102,296	L294F	possibly damaging	Het
Kif6	C	T	17: 49,758,514	Q506*	probably null	Het
Mdn1	C	T	4: 32,657,284	P12S	probably benign	Het
Mrgprb3	T	G	7: 48,643,520	L94F	probably benign	Het
Mycbp2	G	T	14: 103,155,204	P3307Q	probably damaging	Het
Nol8	T	G	13: 49,655,248		probably benign	Het
Olfr1308	T	C	2: 111,960,138	I312V	probably benign	Het
Olfr744	A	G	14: 50,618,384	Y54C	probably benign	Het
Pax5	T	C	4: 44,570,027	H286R	probably benign	Het
Rmdn2	T	A	17: 79,672,537	C381*	probably null	Het
Rpusd4	A	G	9: 35,272,580	I202V	probably benign	Het
Shank3	A	T	15: 89,533,346	R49W	possibly damaging	Het
Smurf2	T	C	11: 106,831,044	T542A	probably benign	Het
Sorcs2	G	A	5: 36,062,588	R371C	probably damaging	Het
Sqstm1	T	C	11: 50,210,561	H66R	probably damaging	Het
Stard8	C	T	X: 99,065,964	S155L	probably benign	Het
Svep1	A	T	4: 58,091,889	V1582D	probably damaging	Het
Tecrl	T	C	5: 83,279,309	M331V	probably damaging	Het
Tinf2	T	C	14: 55,679,585	S368G	probably damaging	Het
Tmem184c	A	T	8: 77,610,185	I14N	probably damaging	Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Ulk4	T	C	9: 121,156,875	*911W	probably null	Het
Unc13b	T	C	4: 43,175,954	F2261L	unknown	Het
Vps16	G	C	2: 130,438,873	G241R	probably damaging	Het
Ythdc1	C	T	5: 86,817,322	T292I	possibly damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCCAGGTTCCAGACTC -3'
(R):5'- GCTCATCATGTGCAGGTGTG -3'

Sequencing Primer
(F):5'- ACTCCAGGGTCCTGACTCCTAG -3'
(R):5'- CTCATCATGTGCAGGTGTGAGTATG -3'

Posted On

2020-07-28