Incidental Mutation 'R8246:Loxhd1'
ID 640780
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms 1700096C21Rik, sba
MMRRC Submission 067852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R8246 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 77369654-77530626 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77451242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 707 (K707R)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000148341]
AlphaFold C8YR32
Predicted Effect probably benign
Transcript: ENSMUST00000035501
AA Change: K474R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818
AA Change: K474R

DomainStartEndE-ValueType
Pfam:PLAT 1 53 3.2e-7 PFAM
LH2 63 176 1.1e-4 SMART
LH2 192 306 4.02e-4 SMART
LH2 320 442 3.79e-6 SMART
LH2 451 567 5.92e-6 SMART
LH2 581 696 7.67e-3 SMART
LH2 793 913 1.47e-11 SMART
low complexity region 922 931 N/A INTRINSIC
SCOP:d1lox_2 949 974 1e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: K707R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: K707R

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148341
AA Change: K388R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: K388R

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 C A 7: 80,742,524 (GRCm39) D780E probably benign Het
Anln A C 9: 22,262,251 (GRCm39) S947A probably benign Het
Borcs6 C T 11: 68,951,377 (GRCm39) P252S probably benign Het
Ccdc42 C A 11: 68,478,122 (GRCm39) Q28K probably benign Het
Cp A G 3: 20,029,186 (GRCm39) I554M probably damaging Het
Dnm3 T G 1: 162,135,486 (GRCm39) D429A probably damaging Het
Dok5 A G 2: 170,642,813 (GRCm39) K37R probably benign Het
Dtwd2 A T 18: 49,831,492 (GRCm39) Y268N probably benign Het
Eif3a T C 19: 60,767,806 (GRCm39) E244G probably damaging Het
Elapor2 T C 5: 9,496,966 (GRCm39) V810A probably benign Het
Fam149a T C 8: 45,834,655 (GRCm39) E48G probably benign Het
Fam186a T A 15: 99,838,428 (GRCm39) E2605D unknown Het
Fhip1b T C 7: 105,038,867 (GRCm39) E124G probably damaging Het
Fyn T A 10: 39,405,525 (GRCm39) W264R probably damaging Het
Gm10024 T A 10: 77,547,369 (GRCm39) S27T unknown Het
Gpr157 C T 4: 150,186,753 (GRCm39) L294F possibly damaging Het
Kif6 C T 17: 50,065,542 (GRCm39) Q506* probably null Het
Klrh1 A G 6: 129,752,339 (GRCm39) probably benign Het
Mcub C A 3: 129,708,814 (GRCm39) V328L probably benign Het
Mdn1 C T 4: 32,657,284 (GRCm39) P12S probably benign Het
Mrgprb3 T G 7: 48,293,268 (GRCm39) L94F probably benign Het
Mycbp2 G T 14: 103,392,640 (GRCm39) P3307Q probably damaging Het
Nol8 T G 13: 49,808,724 (GRCm39) probably benign Het
Or11g2 A G 14: 50,855,841 (GRCm39) Y54C probably benign Het
Or4f57 T C 2: 111,790,483 (GRCm39) I312V probably benign Het
Pax5 T C 4: 44,570,027 (GRCm39) H286R probably benign Het
Rmdn2 T A 17: 79,979,966 (GRCm39) C381* probably null Het
Rpusd4 A G 9: 35,183,876 (GRCm39) I202V probably benign Het
Shank3 A T 15: 89,417,549 (GRCm39) R49W possibly damaging Het
Smurf2 T C 11: 106,721,870 (GRCm39) T542A probably benign Het
Sorcs2 G A 5: 36,219,932 (GRCm39) R371C probably damaging Het
Sqstm1 T C 11: 50,101,388 (GRCm39) H66R probably damaging Het
Stard8 C T X: 98,109,570 (GRCm39) S155L probably benign Het
Svep1 A T 4: 58,091,889 (GRCm39) V1582D probably damaging Het
Tecrl T C 5: 83,427,156 (GRCm39) M331V probably damaging Het
Tinf2 T C 14: 55,917,042 (GRCm39) S368G probably damaging Het
Tmem184c A T 8: 78,336,814 (GRCm39) I14N probably damaging Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Ulk4 T C 9: 120,985,941 (GRCm39) *911W probably null Het
Unc13b T C 4: 43,175,954 (GRCm39) F2261L unknown Het
Vps16 G C 2: 130,280,793 (GRCm39) G241R probably damaging Het
Ythdc1 C T 5: 86,965,181 (GRCm39) T292I possibly damaging Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77,483,146 (GRCm39) missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77,518,770 (GRCm39) missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77,420,263 (GRCm39) missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77,493,672 (GRCm39) missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77,416,897 (GRCm39) missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77,374,120 (GRCm39) missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77,427,797 (GRCm39) missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77,456,833 (GRCm39) missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77,490,648 (GRCm39) missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77,498,235 (GRCm39) missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77,493,628 (GRCm39) missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77,444,609 (GRCm39) missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77,456,811 (GRCm39) splice site probably benign
IGL03032:Loxhd1 APN 18 77,374,169 (GRCm39) missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77,529,480 (GRCm39) missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77,518,809 (GRCm39) missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77,468,160 (GRCm39) missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77,496,446 (GRCm39) missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77,529,369 (GRCm39) missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77,429,627 (GRCm39) missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77,529,464 (GRCm39) missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77,427,196 (GRCm39) missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77,496,474 (GRCm39) missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0049:Loxhd1 UTSW 18 77,468,256 (GRCm39) splice site probably benign
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77,492,562 (GRCm39) missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77,456,833 (GRCm39) missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77,471,526 (GRCm39) splice site probably null
R0367:Loxhd1 UTSW 18 77,513,453 (GRCm39) splice site probably benign
R0709:Loxhd1 UTSW 18 77,492,665 (GRCm39) missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77,517,680 (GRCm39) missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77,517,639 (GRCm39) missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77,493,699 (GRCm39) critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77,490,632 (GRCm39) missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1465:Loxhd1 UTSW 18 77,468,269 (GRCm39) splice site probably null
R1501:Loxhd1 UTSW 18 77,444,528 (GRCm39) missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77,490,259 (GRCm39) missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77,409,364 (GRCm39) missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77,492,498 (GRCm39) missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77,380,937 (GRCm39) missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77,492,585 (GRCm39) missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77,513,335 (GRCm39) missense possibly damaging 0.88
R1796:Loxhd1 UTSW 18 77,493,603 (GRCm39) missense probably damaging 0.96
R1800:Loxhd1 UTSW 18 77,490,198 (GRCm39) missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77,369,667 (GRCm39) missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77,427,833 (GRCm39) missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77,492,504 (GRCm39) missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77,409,338 (GRCm39) missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77,383,465 (GRCm39) missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77,472,642 (GRCm39) missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77,443,862 (GRCm39) missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77,518,774 (GRCm39) missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77,469,719 (GRCm39) missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77,496,464 (GRCm39) missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77,501,855 (GRCm39) missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77,460,025 (GRCm39) missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77,418,755 (GRCm39) missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77,486,697 (GRCm39) missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77,483,123 (GRCm39) missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77,460,607 (GRCm39) missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77,529,456 (GRCm39) missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77,518,828 (GRCm39) missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77,486,785 (GRCm39) missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77,444,608 (GRCm39) missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77,493,642 (GRCm39) missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77,490,581 (GRCm39) missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77,459,987 (GRCm39) missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77,483,153 (GRCm39) missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77,472,663 (GRCm39) missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77,449,432 (GRCm39) missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77,451,308 (GRCm39) missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77,498,268 (GRCm39) missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77,420,378 (GRCm39) missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77,454,237 (GRCm39) missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77,429,751 (GRCm39) missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77,492,647 (GRCm39) missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77,444,573 (GRCm39) missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77,374,105 (GRCm39) missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77,490,211 (GRCm39) missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77,499,946 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77,469,254 (GRCm39) missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77,383,454 (GRCm39) missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77,499,874 (GRCm39) missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77,449,426 (GRCm39) missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77,468,128 (GRCm39) missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77,499,847 (GRCm39) missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77,380,965 (GRCm39) missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77,518,873 (GRCm39) missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77,529,222 (GRCm39) missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77,460,129 (GRCm39) critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77,476,210 (GRCm39) missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77,501,892 (GRCm39) missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77,529,513 (GRCm39) missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77,420,338 (GRCm39) missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77,383,547 (GRCm39) missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77,500,001 (GRCm39) missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77,483,061 (GRCm39) missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77,409,330 (GRCm39) missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77,517,671 (GRCm39) missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77,518,882 (GRCm39) missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77,472,637 (GRCm39) missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77,471,425 (GRCm39) missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77,496,483 (GRCm39) missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77,518,909 (GRCm39) missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77,472,746 (GRCm39) missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77,462,890 (GRCm39) missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77,518,888 (GRCm39) missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77,427,845 (GRCm39) missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77,429,709 (GRCm39) missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77,492,512 (GRCm39) missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77,468,192 (GRCm39) missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77,476,095 (GRCm39) missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77,469,334 (GRCm39) missense possibly damaging 0.77
R8263:Loxhd1 UTSW 18 77,462,858 (GRCm39) missense probably damaging 1.00
R8324:Loxhd1 UTSW 18 77,427,275 (GRCm39) critical splice donor site probably null
R8342:Loxhd1 UTSW 18 77,493,681 (GRCm39) missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77,468,156 (GRCm39) missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77,518,827 (GRCm39) missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77,529,162 (GRCm39) missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77,444,468 (GRCm39) missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77,472,765 (GRCm39) missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77,518,899 (GRCm39) missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77,490,593 (GRCm39) missense probably benign
R9284:Loxhd1 UTSW 18 77,501,826 (GRCm39) missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77,498,285 (GRCm39) missense probably benign 0.05
R9619:Loxhd1 UTSW 18 77,443,871 (GRCm39) missense probably benign 0.32
X0020:Loxhd1 UTSW 18 77,427,258 (GRCm39) nonsense probably null
X0024:Loxhd1 UTSW 18 77,483,099 (GRCm39) missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77,529,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCCAGGTTCCAGACTC -3'
(R):5'- GCTCATCATGTGCAGGTGTG -3'

Sequencing Primer
(F):5'- ACTCCAGGGTCCTGACTCCTAG -3'
(R):5'- CTCATCATGTGCAGGTGTGAGTATG -3'
Posted On 2020-07-28