Incidental Mutation 'R8245:Fer1l4'
ID 640797
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 067673-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8245 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 155886934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,539,870 (GRCm39) probably null Het
Adam4 A T 12: 81,466,657 (GRCm39) C655S probably damaging Het
Adamts13 A C 2: 26,880,568 (GRCm39) D717A probably damaging Het
Atf7ip2 A G 16: 10,019,262 (GRCm39) N30S possibly damaging Het
Bmp8b T C 4: 123,008,532 (GRCm39) V166A probably benign Het
Bpifb9a G A 2: 154,104,646 (GRCm39) G261R probably benign Het
Cdipt G T 7: 126,578,732 (GRCm39) M174I probably benign Het
Cep128 T C 12: 90,966,419 (GRCm39) T1063A probably benign Het
Ciao1 A G 2: 127,088,404 (GRCm39) Y140H probably damaging Het
Cngb1 A G 8: 96,024,408 (GRCm39) S217P unknown Het
Cnot2 T A 10: 116,346,294 (GRCm39) I103F probably benign Het
Col27a1 T G 4: 63,144,040 (GRCm39) V576G probably damaging Het
Dapk1 T A 13: 60,878,710 (GRCm39) H566Q probably benign Het
Dhrs2 T A 14: 55,478,637 (GRCm39) C261S possibly damaging Het
Ercc4 G C 16: 12,948,001 (GRCm39) R406P probably benign Het
Fhod3 T A 18: 25,246,673 (GRCm39) F1293Y probably damaging Het
Fsip1 T A 2: 118,075,359 (GRCm39) K218M unknown Het
Fsip2 G T 2: 82,811,346 (GRCm39) S2555I possibly damaging Het
Gfpt2 A G 11: 49,714,785 (GRCm39) K358E probably benign Het
Gm9637 A T 14: 19,402,598 (GRCm38) V1D noncoding transcript Het
H2-M10.6 T C 17: 37,124,155 (GRCm39) probably null Het
Hand2 A G 8: 57,774,994 (GRCm39) Y18C probably damaging Het
Helz2 A T 2: 180,879,895 (GRCm39) V607E probably damaging Het
Hps5 G A 7: 46,418,485 (GRCm39) R862* probably null Het
Ildr1 A G 16: 36,529,883 (GRCm39) D90G probably damaging Het
Ints12 A G 3: 132,814,633 (GRCm39) N280S probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Itpr2 T A 6: 146,274,604 (GRCm39) K859N probably damaging Het
Lhx9 G T 1: 138,766,179 (GRCm39) A212D probably benign Het
Myo6 C T 9: 80,162,229 (GRCm39) T322I unknown Het
Ndufaf4 A G 4: 24,898,648 (GRCm39) D71G probably benign Het
Nrp1 T A 8: 129,214,434 (GRCm39) S641T probably benign Het
Nudt7 A T 8: 114,863,080 (GRCm39) N37I probably damaging Het
Obscn T A 11: 58,913,066 (GRCm39) I271F Het
Or2ag16 T C 7: 106,352,374 (GRCm39) T74A probably benign Het
Or4d2b G A 11: 87,780,443 (GRCm39) S93F probably damaging Het
Or6c5b T C 10: 129,245,975 (GRCm39) S247P probably damaging Het
Or7g18 T C 9: 18,787,126 (GRCm39) Y168H probably benign Het
Or9g4b A G 2: 85,616,119 (GRCm39) E88G probably benign Het
Oxa1l T C 14: 54,605,274 (GRCm39) S317P probably damaging Het
Poglut2 A T 1: 44,156,226 (GRCm39) H120Q probably benign Het
Polr2a C T 11: 69,630,779 (GRCm39) R1213H probably damaging Het
Postn A T 3: 54,283,468 (GRCm39) S516C probably null Het
Rabep2 A G 7: 126,039,580 (GRCm39) T336A possibly damaging Het
Ralgapb G A 2: 158,285,256 (GRCm39) C585Y probably damaging Het
Rexo4 A G 2: 26,850,350 (GRCm39) S276P probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,229,122 (GRCm39) probably benign Het
Sall3 G A 18: 81,016,969 (GRCm39) P320S probably benign Het
Sipa1l3 A G 7: 29,099,789 (GRCm39) L160P probably damaging Het
Sphkap A G 1: 83,256,492 (GRCm39) F419S probably benign Het
Stag1 C A 9: 100,811,946 (GRCm39) T808K probably benign Het
Stam2 G T 2: 52,604,931 (GRCm39) N201K possibly damaging Het
Stat1 G A 1: 52,194,178 (GRCm39) R704Q probably benign Het
Tacc2 A G 7: 130,331,303 (GRCm39) D2236G probably damaging Het
Thsd7a T A 6: 12,379,592 (GRCm39) Y944F Het
Tmem225 G T 9: 40,061,955 (GRCm39) V190F probably damaging Het
Tonsl A T 15: 76,521,022 (GRCm39) V400D probably benign Het
Tpp2 G A 1: 44,022,712 (GRCm39) G971D probably damaging Het
Trh C T 6: 92,220,050 (GRCm39) V89I probably benign Het
Txlnb A G 10: 17,717,205 (GRCm39) D404G probably damaging Het
Uggt1 A G 1: 36,204,645 (GRCm39) V990A probably damaging Het
Vmn1r179 T A 7: 23,628,396 (GRCm39) Y196N possibly damaging Het
Vmn2r8 T C 5: 108,945,936 (GRCm39) D557G probably damaging Het
Zfp516 G T 18: 82,974,458 (GRCm39) G219C probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGATCAGAGCATCAGGC -3'
(R):5'- TAAGATGCAGAGCCTCCTGG -3'

Sequencing Primer
(F):5'- GCTGAAGGTCAGGTACTACC -3'
(R):5'- AGAGCCTCCTGGACCTTAG -3'
Posted On 2020-07-28