Incidental Mutation 'R0096:Arhgef28'
ID64081
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0096 (G1)
Quality Score120
Status Validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 97931254 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1388 (T1388P)
Ref Sequence ENSEMBL: ENSMUSP00000105053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000225884]
Predicted Effect probably damaging
Transcript: ENSMUST00000109426
AA Change: T1388P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: T1388P

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
Meta Mutation Damage Score 0.4689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7491:Arhgef28 UTSW 13 97944686 missense probably benign 0.03
R7500:Arhgef28 UTSW 13 97978495 missense probably benign 0.00
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
R7813:Arhgef28 UTSW 13 97945681 missense possibly damaging 0.48
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCTGGAACTGGTGTTGAAG -3'
(R):5'- AAGAGTCCACAAGCTGTGCTCG -3'

Sequencing Primer
(F):5'- AACTGGTGTTGAAGCTTGTG -3'
(R):5'- caaaaacaggggaggggg -3'
Posted On2013-08-06