Incidental Mutation 'R8245:Olfr830'
ID640822
Institutional Source Beutler Lab
Gene Symbol Olfr830
Ensembl Gene ENSMUSG00000062868
Gene Nameolfactory receptor 830
SynonymsGA_x6K02T2PVTD-12618399-12619337, MOR152-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R8245 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18874693-18878369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18875830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 168 (Y168H)
Ref Sequence ENSEMBL: ENSMUSP00000077903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078861] [ENSMUST00000212723]
Predicted Effect probably benign
Transcript: ENSMUST00000078861
AA Change: Y168H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077903
Gene: ENSMUSG00000062868
AA Change: Y168H

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7tm_1 44 293 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212723
AA Change: Y165H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,594,144 probably null Het
Adam4 A T 12: 81,419,883 C655S probably damaging Het
Adamts13 A C 2: 26,990,556 D717A probably damaging Het
Atf7ip2 A G 16: 10,201,398 N30S possibly damaging Het
Bmp8b T C 4: 123,114,739 V166A probably benign Het
Bpifb9a G A 2: 154,262,726 G261R probably benign Het
Cdipt G T 7: 126,979,560 M174I probably benign Het
Cep128 T C 12: 90,999,645 T1063A probably benign Het
Ciao1 A G 2: 127,246,484 Y140H probably damaging Het
Cngb1 A G 8: 95,297,780 S217P unknown Het
Cnot2 T A 10: 116,510,389 I103F probably benign Het
Col27a1 T G 4: 63,225,803 V576G probably damaging Het
Dapk1 T A 13: 60,730,896 H566Q probably benign Het
Dhrs2 T A 14: 55,241,180 C261S possibly damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Fer1l4 A G 2: 156,045,014 probably null Het
Fhod3 T A 18: 25,113,616 F1293Y probably damaging Het
Fsip1 T A 2: 118,244,878 K218M unknown Het
Fsip2 G T 2: 82,981,002 S2555I possibly damaging Het
Gfpt2 A G 11: 49,823,958 K358E probably benign Het
Gm44444 T C 10: 129,410,106 S247P probably damaging Het
Gm9637 A T 14: 19,402,598 V1D noncoding transcript Het
H2-M10.6 T C 17: 36,813,263 probably null Het
Hand2 A G 8: 57,321,959 Y18C probably damaging Het
Helz2 A T 2: 181,238,102 V607E probably damaging Het
Hps5 G A 7: 46,769,061 R862* probably null Het
Ildr1 A G 16: 36,709,521 D90G probably damaging Het
Ints12 A G 3: 133,108,872 N280S probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Itpr2 T A 6: 146,373,106 K859N probably damaging Het
Kdelc1 A T 1: 44,117,066 H120Q probably benign Het
Lhx9 G T 1: 138,838,441 A212D probably benign Het
Myo6 C T 9: 80,254,947 T322I unknown Het
Ndufaf4 A G 4: 24,898,648 D71G probably benign Het
Nrp1 T A 8: 128,487,953 S641T probably benign Het
Nudt7 A T 8: 114,136,340 N37I probably damaging Het
Obscn T A 11: 59,022,240 I271F Het
Olfr1015 A G 2: 85,785,775 E88G probably benign Het
Olfr462 G A 11: 87,889,617 S93F probably damaging Het
Olfr698 T C 7: 106,753,167 T74A probably benign Het
Oxa1l T C 14: 54,367,817 S317P probably damaging Het
Polr2a C T 11: 69,739,953 R1213H probably damaging Het
Postn A T 3: 54,376,047 S516C probably null Het
Rabep2 A G 7: 126,440,408 T336A possibly damaging Het
Ralgapb G A 2: 158,443,336 C585Y probably damaging Het
Rexo4 A G 2: 26,960,338 S276P probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,915 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sipa1l3 A G 7: 29,400,364 L160P probably damaging Het
Sphkap A G 1: 83,278,771 F419S probably benign Het
Stag1 C A 9: 100,929,893 T808K probably benign Het
Stam2 G T 2: 52,714,919 N201K possibly damaging Het
Stat1 G A 1: 52,155,019 R704Q probably benign Het
Tacc2 A G 7: 130,729,573 D2236G probably damaging Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTGTGGTTGCTGCTGCTGCTG TTGCTGCTGCTG 17: 50,799,922 probably benign Het
Thsd7a T A 6: 12,379,593 Y944F Het
Tmem225 G T 9: 40,150,659 V190F probably damaging Het
Tpp2 G A 1: 43,983,552 G971D probably damaging Het
Trh C T 6: 92,243,069 V89I probably benign Het
Txlnb A G 10: 17,841,457 D404G probably damaging Het
Uggt1 A G 1: 36,165,564 V990A probably damaging Het
Vmn1r179 T A 7: 23,928,971 Y196N possibly damaging Het
Vmn2r8 T C 5: 108,798,070 D557G probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Other mutations in Olfr830
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Olfr830 APN 9 18876014 nonsense probably null
IGL00954:Olfr830 APN 9 18876073 missense probably benign 0.15
IGL01090:Olfr830 APN 9 18876242 missense probably benign 0.00
IGL01613:Olfr830 APN 9 18875321 splice site probably benign
IGL01987:Olfr830 APN 9 18875707 missense probably benign 0.00
IGL03018:Olfr830 APN 9 18876227 missense probably benign 0.15
IGL03037:Olfr830 APN 9 18875372 missense probably damaging 0.98
R0284:Olfr830 UTSW 9 18875552 missense probably benign
R1322:Olfr830 UTSW 9 18875521 missense possibly damaging 0.90
R1715:Olfr830 UTSW 9 18875794 missense probably benign 0.06
R1803:Olfr830 UTSW 9 18876080 missense probably damaging 1.00
R4360:Olfr830 UTSW 9 18875717 missense probably damaging 1.00
R4394:Olfr830 UTSW 9 18875611 missense probably damaging 0.98
R4642:Olfr830 UTSW 9 18876167 missense probably damaging 1.00
R4796:Olfr830 UTSW 9 18876179 missense probably damaging 0.96
R4814:Olfr830 UTSW 9 18875917 missense probably benign 0.30
R5210:Olfr830 UTSW 9 18875807 missense probably damaging 1.00
R5375:Olfr830 UTSW 9 18876146 missense probably benign 0.08
R6072:Olfr830 UTSW 9 18875422 missense probably benign
R6361:Olfr830 UTSW 9 18875731 missense probably damaging 1.00
R6602:Olfr830 UTSW 9 18875849 missense possibly damaging 0.81
R6920:Olfr830 UTSW 9 18875525 missense probably damaging 1.00
R7730:Olfr830 UTSW 9 18875413 missense probably benign 0.00
R7780:Olfr830 UTSW 9 18875614 missense possibly damaging 0.65
R8274:Olfr830 UTSW 9 18875499 missense probably benign 0.36
X0026:Olfr830 UTSW 9 18875635 missense probably damaging 1.00
Predicted Primers
Posted On2020-07-28