Incidental Mutation 'R0096:Vmn2r105'
ID64084
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0096 (G1)
Quality Score162
Status Validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20227479 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 361 (F361S)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167382
AA Change: F361S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: F361S

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20234782 missense probably benign
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20228496 missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20224618 nonsense probably null
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20234872 start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20208967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCCACAGCATACACAGCATTG -3'
(R):5'- TGTGAAAATGATCCCTGCCACCTG -3'

Sequencing Primer
(F):5'- ACGAGGCAATGCATCCAAAG -3'
(R):5'- CTGGGTCATGAACATTGAACCTC -3'
Posted On2013-08-06