Incidental Mutation 'R8245:Ildr1'
ID 640842
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8245 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36693978-36726804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36709521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000023617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect probably damaging
Transcript: ENSMUST00000023617
AA Change: D90G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089618
AA Change: D90G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119464
AA Change: D90G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,594,144 probably null Het
Adam4 A T 12: 81,419,883 C655S probably damaging Het
Adamts13 A C 2: 26,990,556 D717A probably damaging Het
Atf7ip2 A G 16: 10,201,398 N30S possibly damaging Het
Bmp8b T C 4: 123,114,739 V166A probably benign Het
Bpifb9a G A 2: 154,262,726 G261R probably benign Het
Cdipt G T 7: 126,979,560 M174I probably benign Het
Cep128 T C 12: 90,999,645 T1063A probably benign Het
Ciao1 A G 2: 127,246,484 Y140H probably damaging Het
Cngb1 A G 8: 95,297,780 S217P unknown Het
Cnot2 T A 10: 116,510,389 I103F probably benign Het
Col27a1 T G 4: 63,225,803 V576G probably damaging Het
Dapk1 T A 13: 60,730,896 H566Q probably benign Het
Dhrs2 T A 14: 55,241,180 C261S possibly damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Fer1l4 A G 2: 156,045,014 probably null Het
Fhod3 T A 18: 25,113,616 F1293Y probably damaging Het
Fsip1 T A 2: 118,244,878 K218M unknown Het
Fsip2 G T 2: 82,981,002 S2555I possibly damaging Het
Gfpt2 A G 11: 49,823,958 K358E probably benign Het
Gm44444 T C 10: 129,410,106 S247P probably damaging Het
Gm9637 A T 14: 19,402,598 V1D noncoding transcript Het
H2-M10.6 T C 17: 36,813,263 probably null Het
Hand2 A G 8: 57,321,959 Y18C probably damaging Het
Helz2 A T 2: 181,238,102 V607E probably damaging Het
Hps5 G A 7: 46,769,061 R862* probably null Het
Ints12 A G 3: 133,108,872 N280S probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Itpr2 T A 6: 146,373,106 K859N probably damaging Het
Kdelc1 A T 1: 44,117,066 H120Q probably benign Het
Lhx9 G T 1: 138,838,441 A212D probably benign Het
Myo6 C T 9: 80,254,947 T322I unknown Het
Ndufaf4 A G 4: 24,898,648 D71G probably benign Het
Nrp1 T A 8: 128,487,953 S641T probably benign Het
Nudt7 A T 8: 114,136,340 N37I probably damaging Het
Obscn T A 11: 59,022,240 I271F Het
Olfr1015 A G 2: 85,785,775 E88G probably benign Het
Olfr462 G A 11: 87,889,617 S93F probably damaging Het
Olfr698 T C 7: 106,753,167 T74A probably benign Het
Olfr830 T C 9: 18,875,830 Y168H probably benign Het
Oxa1l T C 14: 54,367,817 S317P probably damaging Het
Polr2a C T 11: 69,739,953 R1213H probably damaging Het
Postn A T 3: 54,376,047 S516C probably null Het
Rabep2 A G 7: 126,440,408 T336A possibly damaging Het
Ralgapb G A 2: 158,443,336 C585Y probably damaging Het
Rexo4 A G 2: 26,960,338 S276P probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,915 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sipa1l3 A G 7: 29,400,364 L160P probably damaging Het
Sphkap A G 1: 83,278,771 F419S probably benign Het
Stag1 C A 9: 100,929,893 T808K probably benign Het
Stam2 G T 2: 52,714,919 N201K possibly damaging Het
Stat1 G A 1: 52,155,019 R704Q probably benign Het
Tacc2 A G 7: 130,729,573 D2236G probably damaging Het
Thsd7a T A 6: 12,379,593 Y944F Het
Tmem225 G T 9: 40,150,659 V190F probably damaging Het
Tonsl A T 15: 76,636,822 V400D probably benign Het
Tpp2 G A 1: 43,983,552 G971D probably damaging Het
Trh C T 6: 92,243,069 V89I probably benign Het
Txlnb A G 10: 17,841,457 D404G probably damaging Het
Uggt1 A G 1: 36,165,564 V990A probably damaging Het
Vmn1r179 T A 7: 23,928,971 Y196N possibly damaging Het
Vmn2r8 T C 5: 108,798,070 D557G probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36722350 missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36716164 missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36709477 critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36708319 missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36708336 missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36716206 missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36725541 missense probably damaging 0.97
R2110:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R2111:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36722021 missense probably benign 0.00
R4798:Ildr1 UTSW 16 36722555 missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36708298 missense probably benign 0.10
R5014:Ildr1 UTSW 16 36721559 missense probably damaging 0.98
R5426:Ildr1 UTSW 16 36709619 missense probably damaging 1.00
R5957:Ildr1 UTSW 16 36725534 makesense probably null
R7058:Ildr1 UTSW 16 36722368 missense probably benign 0.01
R7646:Ildr1 UTSW 16 36721919 missense possibly damaging 0.78
R8392:Ildr1 UTSW 16 36722358 nonsense probably null
R8392:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R8748:Ildr1 UTSW 16 36722372 missense probably benign 0.18
R8791:Ildr1 UTSW 16 36708400 missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36715548 missense probably damaging 1.00
R9108:Ildr1 UTSW 16 36715557 missense probably benign 0.13
R9252:Ildr1 UTSW 16 36716212 missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36709500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGGCTTGGAGGCTTATC -3'
(R):5'- TGACCAGTTCAGTCATCGAGC -3'

Sequencing Primer
(F):5'- GCTTATCGATGCGATGCAAG -3'
(R):5'- GGAATCCCTTGCTGACTCAG -3'
Posted On 2020-07-28