Incidental Mutation 'R8245:H2-M10.6'
ID640843
Institutional Source Beutler Lab
Gene Symbol H2-M10.6
Ensembl Gene ENSMUSG00000037130
Gene Namehistocompatibility 2, M region locus 10.6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8245 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36812171-36815564 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 36813263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041398]
Predicted Effect probably null
Transcript: ENSMUST00000041398
SMART Domains Protein: ENSMUSP00000039908
Gene: ENSMUSG00000037130

DomainStartEndE-ValueType
Pfam:MHC_I 24 202 2.2e-47 PFAM
IGc1 221 292 9.31e-22 SMART
transmembrane domain 305 327 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,594,144 probably null Het
Adam4 A T 12: 81,419,883 C655S probably damaging Het
Adamts13 A C 2: 26,990,556 D717A probably damaging Het
Atf7ip2 A G 16: 10,201,398 N30S possibly damaging Het
Bmp8b T C 4: 123,114,739 V166A probably benign Het
Bpifb9a G A 2: 154,262,726 G261R probably benign Het
Cdipt G T 7: 126,979,560 M174I probably benign Het
Cep128 T C 12: 90,999,645 T1063A probably benign Het
Ciao1 A G 2: 127,246,484 Y140H probably damaging Het
Cngb1 A G 8: 95,297,780 S217P unknown Het
Cnot2 T A 10: 116,510,389 I103F probably benign Het
Col27a1 T G 4: 63,225,803 V576G probably damaging Het
Dapk1 T A 13: 60,730,896 H566Q probably benign Het
Dhrs2 T A 14: 55,241,180 C261S possibly damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Fer1l4 A G 2: 156,045,014 probably null Het
Fhod3 T A 18: 25,113,616 F1293Y probably damaging Het
Fsip1 T A 2: 118,244,878 K218M unknown Het
Fsip2 G T 2: 82,981,002 S2555I possibly damaging Het
Gfpt2 A G 11: 49,823,958 K358E probably benign Het
Gm44444 T C 10: 129,410,106 S247P probably damaging Het
Gm9637 A T 14: 19,402,598 V1D noncoding transcript Het
Hand2 A G 8: 57,321,959 Y18C probably damaging Het
Helz2 A T 2: 181,238,102 V607E probably damaging Het
Hps5 G A 7: 46,769,061 R862* probably null Het
Ildr1 A G 16: 36,709,521 D90G probably damaging Het
Ints12 A G 3: 133,108,872 N280S probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Itpr2 T A 6: 146,373,106 K859N probably damaging Het
Kdelc1 A T 1: 44,117,066 H120Q probably benign Het
Lhx9 G T 1: 138,838,441 A212D probably benign Het
Myo6 C T 9: 80,254,947 T322I unknown Het
Ndufaf4 A G 4: 24,898,648 D71G probably benign Het
Nrp1 T A 8: 128,487,953 S641T probably benign Het
Nudt7 A T 8: 114,136,340 N37I probably damaging Het
Obscn T A 11: 59,022,240 I271F Het
Olfr1015 A G 2: 85,785,775 E88G probably benign Het
Olfr462 G A 11: 87,889,617 S93F probably damaging Het
Olfr698 T C 7: 106,753,167 T74A probably benign Het
Olfr830 T C 9: 18,875,830 Y168H probably benign Het
Oxa1l T C 14: 54,367,817 S317P probably damaging Het
Polr2a C T 11: 69,739,953 R1213H probably damaging Het
Postn A T 3: 54,376,047 S516C probably null Het
Rabep2 A G 7: 126,440,408 T336A possibly damaging Het
Ralgapb G A 2: 158,443,336 C585Y probably damaging Het
Rexo4 A G 2: 26,960,338 S276P probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,915 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sipa1l3 A G 7: 29,400,364 L160P probably damaging Het
Sphkap A G 1: 83,278,771 F419S probably benign Het
Stag1 C A 9: 100,929,893 T808K probably benign Het
Stam2 G T 2: 52,714,919 N201K possibly damaging Het
Stat1 G A 1: 52,155,019 R704Q probably benign Het
Tacc2 A G 7: 130,729,573 D2236G probably damaging Het
Thsd7a T A 6: 12,379,593 Y944F Het
Tmem225 G T 9: 40,150,659 V190F probably damaging Het
Tonsl A T 15: 76,636,822 V400D probably benign Het
Tpp2 G A 1: 43,983,552 G971D probably damaging Het
Trh C T 6: 92,243,069 V89I probably benign Het
Txlnb A G 10: 17,841,457 D404G probably damaging Het
Uggt1 A G 1: 36,165,564 V990A probably damaging Het
Vmn1r179 T A 7: 23,928,971 Y196N possibly damaging Het
Vmn2r8 T C 5: 108,798,070 D557G probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Other mutations in H2-M10.6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:H2-M10.6 APN 17 36812220 missense probably benign 0.13
IGL01590:H2-M10.6 APN 17 36812749 missense probably benign 0.05
IGL03200:H2-M10.6 APN 17 36814016 missense probably damaging 1.00
IGL03278:H2-M10.6 APN 17 36813823 missense probably damaging 0.99
R0018:H2-M10.6 UTSW 17 36814049 missense probably damaging 1.00
R0144:H2-M10.6 UTSW 17 36812241 missense probably damaging 0.99
R0194:H2-M10.6 UTSW 17 36814042 missense probably damaging 1.00
R1168:H2-M10.6 UTSW 17 36813160 missense probably benign
R1757:H2-M10.6 UTSW 17 36813151 missense probably benign 0.00
R1773:H2-M10.6 UTSW 17 36812184 missense probably benign 0.00
R2029:H2-M10.6 UTSW 17 36813907 missense possibly damaging 0.47
R3409:H2-M10.6 UTSW 17 36814001 missense probably damaging 1.00
R3856:H2-M10.6 UTSW 17 36812504 missense probably benign 0.18
R4373:H2-M10.6 UTSW 17 36813066 missense probably damaging 1.00
R4869:H2-M10.6 UTSW 17 36812533 missense probably benign 0.04
R5684:H2-M10.6 UTSW 17 36813854 missense probably damaging 1.00
R6020:H2-M10.6 UTSW 17 36813067 missense probably damaging 1.00
R6180:H2-M10.6 UTSW 17 36814286 missense probably damaging 1.00
R6328:H2-M10.6 UTSW 17 36813944 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATGGGAGCTTCCTCGAAG -3'
(R):5'- AATCCTCTGGAGAGTCCCTC -3'

Sequencing Primer
(F):5'- CCGGCTCACATACTATGGATATG -3'
(R):5'- CTCTCATGTTGAGTCAGGAAACC -3'
Posted On2020-07-28