Incidental Mutation 'R8245:Sall3'
ID640846
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8245 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80973754 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 320 (P320S)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: P320S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: P320S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,594,144 probably null Het
Adam4 A T 12: 81,419,883 C655S probably damaging Het
Adamts13 A C 2: 26,990,556 D717A probably damaging Het
Atf7ip2 A G 16: 10,201,398 N30S possibly damaging Het
Bmp8b T C 4: 123,114,739 V166A probably benign Het
Bpifb9a G A 2: 154,262,726 G261R probably benign Het
Cdipt G T 7: 126,979,560 M174I probably benign Het
Cep128 T C 12: 90,999,645 T1063A probably benign Het
Ciao1 A G 2: 127,246,484 Y140H probably damaging Het
Cngb1 A G 8: 95,297,780 S217P unknown Het
Cnot2 T A 10: 116,510,389 I103F probably benign Het
Col27a1 T G 4: 63,225,803 V576G probably damaging Het
Dapk1 T A 13: 60,730,896 H566Q probably benign Het
Dhrs2 T A 14: 55,241,180 C261S possibly damaging Het
Ercc4 G C 16: 13,130,137 R406P probably benign Het
Fer1l4 A G 2: 156,045,014 probably null Het
Fhod3 T A 18: 25,113,616 F1293Y probably damaging Het
Fsip1 T A 2: 118,244,878 K218M unknown Het
Fsip2 G T 2: 82,981,002 S2555I possibly damaging Het
Gfpt2 A G 11: 49,823,958 K358E probably benign Het
Gm44444 T C 10: 129,410,106 S247P probably damaging Het
Gm9637 A T 14: 19,402,598 V1D noncoding transcript Het
H2-M10.6 T C 17: 36,813,263 probably null Het
Hand2 A G 8: 57,321,959 Y18C probably damaging Het
Helz2 A T 2: 181,238,102 V607E probably damaging Het
Hps5 G A 7: 46,769,061 R862* probably null Het
Ildr1 A G 16: 36,709,521 D90G probably damaging Het
Ints12 A G 3: 133,108,872 N280S probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Itpr2 T A 6: 146,373,106 K859N probably damaging Het
Kdelc1 A T 1: 44,117,066 H120Q probably benign Het
Lhx9 G T 1: 138,838,441 A212D probably benign Het
Myo6 C T 9: 80,254,947 T322I unknown Het
Ndufaf4 A G 4: 24,898,648 D71G probably benign Het
Nrp1 T A 8: 128,487,953 S641T probably benign Het
Nudt7 A T 8: 114,136,340 N37I probably damaging Het
Obscn T A 11: 59,022,240 I271F Het
Olfr1015 A G 2: 85,785,775 E88G probably benign Het
Olfr462 G A 11: 87,889,617 S93F probably damaging Het
Olfr698 T C 7: 106,753,167 T74A probably benign Het
Olfr830 T C 9: 18,875,830 Y168H probably benign Het
Oxa1l T C 14: 54,367,817 S317P probably damaging Het
Polr2a C T 11: 69,739,953 R1213H probably damaging Het
Postn A T 3: 54,376,047 S516C probably null Het
Rabep2 A G 7: 126,440,408 T336A possibly damaging Het
Ralgapb G A 2: 158,443,336 C585Y probably damaging Het
Rexo4 A G 2: 26,960,338 S276P probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCTGCGGCGGC 7: 97,579,915 probably benign Het
Sipa1l3 A G 7: 29,400,364 L160P probably damaging Het
Sphkap A G 1: 83,278,771 F419S probably benign Het
Stag1 C A 9: 100,929,893 T808K probably benign Het
Stam2 G T 2: 52,714,919 N201K possibly damaging Het
Stat1 G A 1: 52,155,019 R704Q probably benign Het
Tacc2 A G 7: 130,729,573 D2236G probably damaging Het
Thsd7a T A 6: 12,379,593 Y944F Het
Tmem225 G T 9: 40,150,659 V190F probably damaging Het
Tonsl A T 15: 76,636,822 V400D probably benign Het
Tpp2 G A 1: 43,983,552 G971D probably damaging Het
Trh C T 6: 92,243,069 V89I probably benign Het
Txlnb A G 10: 17,841,457 D404G probably damaging Het
Uggt1 A G 1: 36,165,564 V990A probably damaging Het
Vmn1r179 T A 7: 23,928,971 Y196N possibly damaging Het
Vmn2r8 T C 5: 108,798,070 D557G probably damaging Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGGCAGCAATGCTAACCAG -3'
(R):5'- TCAGTACAGCTTCAGGGTCTGAC -3'

Sequencing Primer
(F):5'- TTGGGGAAGATGACACTGCTG -3'
(R):5'- TCAGGGTCTGACTCCCCATG -3'
Posted On2020-07-28