Incidental Mutation 'R8244:Ankar'
ID 640849
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8244 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72651024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1216 (I1216T)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably benign
Transcript: ENSMUST00000053499
AA Change: I1216T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: I1216T

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211837
AA Change: I1215T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212573
AA Change: I998T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,579 I133T probably damaging Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Alg5 A G 3: 54,738,800 I29V probably benign Het
Ap5z1 A T 5: 142,473,980 T462S possibly damaging Het
Apc2 A T 10: 80,315,332 R2073S probably damaging Het
Apob A T 12: 8,010,548 E3010V probably damaging Het
Arid3c T G 4: 41,729,997 E66A possibly damaging Het
Atf7 A G 15: 102,528,866 S54P unknown Het
Cbx3 C T 6: 51,475,370 T55I probably benign Het
Clptm1 A T 7: 19,638,991 F205I possibly damaging Het
Cramp1l T A 17: 24,971,410 I1117F probably damaging Het
Dgkq A G 5: 108,648,712 *935Q probably null Het
Dock2 A T 11: 34,695,453 F511I probably damaging Het
Efr3a G A 15: 65,815,368 R15H probably damaging Het
Ehmt2 A G 17: 34,905,262 D385G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gfpt1 T A 6: 87,063,631 probably benign Het
Gm13103 T C 4: 143,853,284 Y480H probably damaging Het
Gm21680 T C 5: 25,968,985 E207G probably damaging Het
Igsf23 A T 7: 19,941,873 C141S possibly damaging Het
Ktn1 A T 14: 47,674,823 E349V probably null Het
Lrp1b T C 2: 41,506,782 D424G Het
Lrrc9 A G 12: 72,499,610 I1190V probably benign Het
Lztfl1 T A 9: 123,712,449 I102F probably damaging Het
Mapk11 G T 15: 89,145,804 T203K possibly damaging Het
Mgam T A 6: 40,750,586 I1315N probably damaging Het
Nf1 T C 11: 79,440,924 M695T probably benign Het
Pdcd4 A G 19: 53,907,534 T8A probably benign Het
Ptx4 A G 17: 25,122,865 K105E possibly damaging Het
Pxn C T 5: 115,552,243 P381L probably damaging Het
Rtn4rl1 T C 11: 75,265,450 L236P probably damaging Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sh2b2 G T 5: 136,227,437 S247* probably null Het
Sim2 T A 16: 94,109,363 V208E probably damaging Het
Slc44a4 T C 17: 34,921,572 L247P probably damaging Het
Sox1 GGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGG 8: 12,396,468 probably benign Het
Tacc2 A G 7: 130,728,676 D1937G probably damaging Het
Tmem131 T C 1: 36,808,893 N1158S probably benign Het
Tns1 G T 1: 73,937,251 A1146E probably damaging Het
Tom1l1 T C 11: 90,657,821 E308G probably benign Het
Ttn T A 2: 76,828,707 K12262* probably null Het
Vps13b G T 15: 35,917,203 G3731V probably damaging Het
Wdr20 G A 12: 110,793,642 E321K probably benign Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zfp979 A T 4: 147,613,476 C259S possibly damaging Het
Zscan20 T C 4: 128,585,966 T911A probably benign Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTCTTGGACACAAAGCTTGTTC -3'
(R):5'- GCCTGTCATAGTCACTGTTGTG -3'

Sequencing Primer
(F):5'- AAGCTTGTTCCTTTGTATAGATGTC -3'
(R):5'- AGGGGAGTAATGTAACCTGTGCTC -3'
Posted On 2020-07-28