Incidental Mutation 'R8244:Atf7'
ID640884
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Nameactivating transcription factor 7
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8244 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102525946-102625464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102528866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000093857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023814] [ENSMUST00000096143] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906]
Predicted Effect probably benign
Transcript: ENSMUST00000023814
SMART Domains Protein: ENSMUSP00000023814
Gene: ENSMUSG00000023052

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NPFF 24 114 3.1e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000096143
AA Change: S54P
Predicted Effect probably benign
Transcript: ENSMUST00000184485
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184616
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184772
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184906
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,579 I133T probably damaging Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Alg5 A G 3: 54,738,800 I29V probably benign Het
Ankar A G 1: 72,651,024 I1216T probably benign Het
Ap5z1 A T 5: 142,473,980 T462S possibly damaging Het
Apc2 A T 10: 80,315,332 R2073S probably damaging Het
Apob A T 12: 8,010,548 E3010V probably damaging Het
Arid3c T G 4: 41,729,997 E66A possibly damaging Het
Cbx3 C T 6: 51,475,370 T55I probably benign Het
Clptm1 A T 7: 19,638,991 F205I possibly damaging Het
Cramp1l T A 17: 24,971,410 I1117F probably damaging Het
Dgkq A G 5: 108,648,712 *935Q probably null Het
Dock2 A T 11: 34,695,453 F511I probably damaging Het
Efr3a G A 15: 65,815,368 R15H probably damaging Het
Ehmt2 A G 17: 34,905,262 D385G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gfpt1 T A 6: 87,063,631 probably benign Het
Gm13103 T C 4: 143,853,284 Y480H probably damaging Het
Gm21680 T C 5: 25,968,985 E207G probably damaging Het
Igsf23 A T 7: 19,941,873 C141S possibly damaging Het
Ktn1 A T 14: 47,674,823 E349V probably null Het
Lrp1b T C 2: 41,506,782 D424G Het
Lrrc9 A G 12: 72,499,610 I1190V probably benign Het
Lztfl1 T A 9: 123,712,449 I102F probably damaging Het
Mapk11 G T 15: 89,145,804 T203K possibly damaging Het
Mgam T A 6: 40,750,586 I1315N probably damaging Het
Nf1 T C 11: 79,440,924 M695T probably benign Het
Pdcd4 A G 19: 53,907,534 T8A probably benign Het
Ptx4 A G 17: 25,122,865 K105E possibly damaging Het
Pxn C T 5: 115,552,243 P381L probably damaging Het
Rtn4rl1 T C 11: 75,265,450 L236P probably damaging Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sh2b2 G T 5: 136,227,437 S247* probably null Het
Sim2 T A 16: 94,109,363 V208E probably damaging Het
Slc44a4 T C 17: 34,921,572 L247P probably damaging Het
Sox1 GGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGG 8: 12,396,468 probably benign Het
Tacc2 A G 7: 130,728,676 D1937G probably damaging Het
Tmem131 T C 1: 36,808,893 N1158S probably benign Het
Tns1 G T 1: 73,937,251 A1146E probably damaging Het
Tom1l1 T C 11: 90,657,821 E308G probably benign Het
Ttn T A 2: 76,828,707 K12262* probably null Het
Vps13b G T 15: 35,917,203 G3731V probably damaging Het
Wdr20 G A 12: 110,793,642 E321K probably benign Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zfp979 A T 4: 147,613,476 C259S possibly damaging Het
Zscan20 T C 4: 128,585,966 T911A probably benign Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102551478 nonsense probably null
R2183:Atf7 UTSW 15 102546473 missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102529004 intron probably benign
R3114:Atf7 UTSW 15 102534423 missense probably benign 0.10
R3115:Atf7 UTSW 15 102534423 missense probably benign 0.10
R4544:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4545:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4546:Atf7 UTSW 15 102534327 missense probably benign 0.08
R5148:Atf7 UTSW 15 102547173 missense probably benign 0.02
R5568:Atf7 UTSW 15 102563322 missense probably damaging 0.99
R5688:Atf7 UTSW 15 102551509 missense probably damaging 1.00
R5805:Atf7 UTSW 15 102557587 splice site probably null
R6021:Atf7 UTSW 15 102557473 missense probably benign 0.20
R6259:Atf7 UTSW 15 102547238 missense probably damaging 1.00
R6347:Atf7 UTSW 15 102546479 missense possibly damaging 0.91
R6476:Atf7 UTSW 15 102593712 missense probably benign 0.13
R6794:Atf7 UTSW 15 102557465 missense probably benign 0.09
R7104:Atf7 UTSW 15 102534235 missense probably benign 0.40
R7369:Atf7 UTSW 15 102553809 missense probably damaging 0.98
R8111:Atf7 UTSW 15 102563334 missense probably damaging 0.96
X0027:Atf7 UTSW 15 102593670 critical splice donor site probably null
Z1088:Atf7 UTSW 15 102547182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCACAGTATATGTCAGGGC -3'
(R):5'- GTGGAGCCTCCTACATCCTGATAG -3'

Sequencing Primer
(F):5'- CACAGTATATGTCAGGGCAAGGG -3'
(R):5'- CCTGATAGAGTATATGTTGAGAAGCC -3'
Posted On2020-07-28